8-3842-33-85-00 - магазин жидких обоев

г. Кемерово, Рынок "Привоз" бокс №1

Frap производитель страна: FRAP — Настоящее немецкое качество

Содержание

О компании FRAP

Группа компаний Frap

Является одним из ведущих производителей сантехнического оборудования на российском рынке. За более чем 15 лет работы компания Frap завоевала заслуженное признание специалистов и уважение потребителей. Огромное количество престижных наград и сертификатов качества — яркое подтверждение эффективности нашей работы в сфере создания высокотехнологичного сантехнического оборудования.

Основное производство, занимающее более 30 000 квадратных метров, и головной офис холдинга Frap находится в живописном китайском городе Ханчжоу. Силами ведущих инженеров, дизайнеров и высококвалифицированных рабочих на производстве, оснащенном самым передовых оборудованием, ежедневно производится целый спектр первоклассных сантехнических изделий. Безупречное качество продукции обеспечивают современные станки с числовым программным управлением, высокоточные линии литья и обработки, а также использование высококачественных материалов.

В результате тесного сотрудничества и обмена опыта инженеров компании Frap с европейскими и американскими производителями сантехнического оборудования, продукция холдинга соответствует общеевропейским стандартам СЕ, американскому стандарту UL и международным стандартам систем менеджмента качества IS0 9001 и экологической эффективности ISO 14001.



Актуальный дизайн и безупречное качество

Стандартная подпись

Продукцию от компании Frap всегда отличает актуальный дизайн всей линейки сантехнических изделий, их безупречное качество, передовые технологии и высокая износостойкость. Холдинг Frap всегда находится в поиске новых идей, внедряя инновационные технологии в своей отрасли, что делает его одним из самых передовых брендов на рынке сантехнического оборудования.

Вся продукция компании Frap прошла необходимую сертификацию в России, а грамотно организованная логистика позволила оперативно поставлять практически любые объемы своей продукции в более чем семьдесят регионов России и страны ближнего зарубежья.
Устанавливая самые высокие цели, компания Frap стремится не просто производить качественную продукцию, но и создавать тем самым по-настоящему комфортную среду жизни для своих потребителей.

страна-производитель изделий для ванны, приспособления для раковины от фирмы, новинки-2021, отзывы сантехников

При обустройстве или ремонте помещения очень важно, чтобы всего его составляющие работали как единый, слаженный механизм. Становится грустно, когда что-либо выходит из строя. В самый неподходящий момент. Часто такую проблему имеют смесители и душевые комплекты. Выбирая надежного производителя, вы, конечно, получите большое количество советов в пользу самых современных европейских торговых марок. За сантехнические изделия которых вам придется выложить приличную сумму.

О наиболее ярком производителе, с которым возможно сэкономить на стоимости, но остаться на высоте в качестве и внешнем виде смесителей, пойдет речь в данной статье.

Особенности

Торговая марка Frap появилась на российском рынке уже более 15 лет назад. Используя новейшие разработки в сфере сантехнических аксессуаров, китайский производитель наладил выпуск широкого ассортимента продукции. В продаже сегодня можно найти аксессуары для ванных комнат (ершики, мыльницы, крючки, светильники и прочее), смесители, душевые системы, мойки, зеркала и раковины. Ощутимым плюсом компании Frap является производство всевозможных комплектующих для сантехники и даже шторок для душа.

Несмотря на то что страна-производитель данной продукции – Китай, все товары выполнены достаточно качественно и даже стильно. Особенностью сантехнических изделий этого бренда является наличие как бюджетных вариантов смесителей, так и более дорогостоящих – люксовых – моделей.

Продукция китайского производителя обладает всеми необходимыми сертификатами качества и экологичности:

  • общеевропейский стандарт CE;
  • американский UL;
  • международные ISO 9001 (качество) и ISO 14001 (экология).

Производитель настаивает на том, что в основе производства лежат немецкие технологии и качество. Но как же тогда продукция может иметь такую экономичную цену – объясняется просто. Немецкая компания Grohe продала китайцам свою лицензию на производство аналогов моделей, которые для немцев уже считаются устаревшими, но не менее качественными.

В России торговая марка Frap также прошла необходимую сертификацию и вот уже более пятнадцати лет радует отечественного потребителя своей продукцией как эконом-, так и премиум-класса.

Об основных положительных и отрицательных сторонах сантехнических смесителей речь пойдет далее.

Плюсы и минусы

Среди неоспоримых плюсов смесителей данного производителя стоит выделить некоторые основные свойства.

  • Экономичная стоимость и не страдающее от этого качество.
  • Использование экологически чистых сырья и технологии производства.
  • Большое разнообразие форм, размеров, цветов, способ монтажа.
  • Наличие функциональных опций. Например, смеситель с гибким изливом для кухни. Смеситель для ванны, способный выдержать максимальное давление – напор воды.
  • Керамический картридж.

И хотя последний пункт можно отнести как к плюсам, так и к минусам, лучше уж оставить его на рубеже этих двух крайностей. Говоря же о недостатках смесителей, можно заметить наличие незначительного количества бракованных позиций, определить которые лучше воочию, не прибегая к онлайн-покупкам. Но также на сегодняшний день существует большое количество подделок этой фирмы, которые не стесняются ставить еще ниже стоимость и продавать откровенно некачественные вещи.

Определить оригинал можно при помощи магнита: он должен притягиваться к смесителю.

Вес также имеет значение. Хотя материалы для экономвариантов Frap имеют небольшую массу, но все же весят несколько больше, чем воздух.

Разновидности

Все смесители китайского производителя можно поделить на несколько категорий, о которых далее пойдет речь более подробно. По функциональному предназначению они делятся на несколько разновидностей.

  • Для кухни. Место для приготовления и приема пищи должно быть на высоте, чтобы там хотелось находиться и творить кулинарные шедевры для себя и своей семьи. Если в доме нет посудомоечной машины, то на вашу кухню отлично подойдут смесители с длинным изливом, иногда с гибким шлангом – душем. Такой вид кранов помогает не только помыть посуду и продукты. В некоторые модели встроены два аэратора, один из которых подключается к центральному водоснабжению, а второй может выступать в качестве крана отфильтрованной воды.
  • Для раковины. Любителям минимализма и желающим просто поставить на кухне мойку с небольшим краном, подойдут модели невысоких смесителей. Frap представляет в этой категории сенсорные краны, изделия с рычагом (для изменения теплоты воды и напора), вентильные, термостатические и кнопочные.
  • Для ванны зачастую используются смесители с нижним изливом, который позволяет беспрепятственно и без потерь набрать душистую ванну и полежать в ней с удовольствием. Но также имеются модели с термостатичными свойствами. Таким образом, можно не переживать за перепады температуры воды в системе. Особенно это касается семей с детьми. Благодаря такому новшеству китайской компании, страх за внезапную подачу кипятка из крана отходит.
  • Для душа. Здесь производитель делает акцент на смесители без излива.

    Что касается функциональной направленности каждой модели, то она очевидна, практична и актуальна. По внешнему же виду можно разделить продукцию Frap на три вида: стандарт, ретро и модерн. Стандартные модели производятся в соответствии с имеющимися мировыми стандартами, без изысков и фантазии. Изготовлены они зачастую из латуни, силумина и алюминия. Среди ретромоделей можно встретить смесители под бронзу, с изысканными и утонченными формами. Категория модерн же позволяет внести в жизнь капельку разнообразия, предлагая самую разнообразную цветовую гамму: черный, белый, оранжевый, зеленый, бежевый, серый и коричневый.

    Силиконовые модели встречаются очень часто в сочетании с высоким изливом, также радуют глаз обширной палитрой. А уникальный смеситель-водопад имеет каскадный спуск воды. Чаша его обычно изготовлена из стекла.

    У современных российских покупателей уже наметились даже свои любимчики среди смесителей компании Frap. О них речь пойдет ниже.

    Наиболее востребованные модели

    Итак, победителями в категории «для кухни» становятся F4909 и F4927. Это – хромированные двухвентильные смесители с высоким изливом, одним стандартным аэратором. Классические модели.

    Следующим чемпионом по праву становится кран для умывальника F10703-B. Современная однорычажная низкая модель очень компактно и уютно смотрится как в кухне, так и в ванной.

    G2245 и F3014-B – привычные стандартные смесители для ванны. Первый оснащен поворотным механизмом переключения на душ и двумя вентилями. Второй обеспечивает нажимное переключение и имеет всего лишь один рычаг, позволяющий включать, выключать и регулировать воду одной рукой.

    В последнее время торговая марка Frap активно внедряет в свое производство европейские технологии и дизайн. Так, благодаря наследованию известных брендов в ассортименте китайского производителя появились дизайнерские новинки, которые радуют не только своим внешним видом и сходством с прославленными брендами.

    Обновленные смесители могут показать высокое качество при правильной установке и эксплуатации сантехнического изделия.

    Установка

    Зачастую смесители Frap достаточно просты в установке. Однако есть несколько нюансов, на которые стоит обратить внимание еще на этапе приобретения.

    По типу монтажа краны делятся на три основные группы.

    1. Встраиваемые. Такие модели обычно крепятся непосредственно на ванну, тумбу или раковину. Используются в комнатах, где все канализационные и водопроводные трубы скрыты от глаз.
    2. Центральные. Установка происходит в вертикальном положении на раковинах и мойках. Чаще всего это модели, имеющие высокий излив, реже – с низким.
    3. Настенные. Смесители этой группы устанавливаются на водопроводные трубы, находящиеся непосредственно на стене помещения. Наиболее распространены в ванных комнатах.

    Монтаж последних производится максимально просто и быстро. Как правило, они устанавливаются на два отверстия. В первую очередь в водопроводные трубы монтируются эксцентрики. Следующим этапом идет накрутка отражателей. Сделать это необходимо максимально, чтобы они были очень близко к стене или к трубе. Следующим шагом будет изоляция эксцентриков, чтобы они не протекали в процессе эксплуатации. Чаще всего для этого используется льняная нитка или ФУМ-лента. Финал – установка смесителя непосредственно. Очень важно не перетянуть накрутки всех комплектующих. Несмотря на качество материалов и производства, есть риск сорвать резьбу или вовсе получить трещину.

    Собрать и установить смеситель собственноручно не представляет особой сложности. Но иногда происходят такие непредвиденные ситуации, когда необходим ремонт конструкции. Как с ним справиться самостоятельно и что для этого необходимо, разберемся далее.

    Ремонт

    Прежде чем приступать к ремонту смесителя своими руками, необходимо разобраться в первопричине проблемы. Одной из самых распространенных неувязок в работе конструкций Frap является износ керамического картриджа изделия. Из-за этого может возникать течь.

    Радует тот факт, что компания производит не только смесители, но и запчасти к ним. То есть можно приобрести любые родные комплектующие без риска купить не того качества, размера или типа.

    Поэтапная инструкция по замене картриджа в однорычажной модели предполагает, что вам необходимо разобрать смеситель Frap.

    • Перекрыть подачу воды в кран.
    • Снять ручку, открутив винтик шестигранным воротком на 2,5.
    • Открутить полусферу. Если кран используется давно, здесь может возникнуть проблема: «прикипание» ручки к телу смесителя. На помощь приходит обычный столовый уксус. Обрабатываем место «прироста», снимаем ручку.
    • Открутить гайку картриджа при помощи ключа. Вынуть картридж.
    • Привести в порядок место, где находился «провинившийся»: очистить от налета и, возможно, ржавчины.
    • Вставить новый картридж, и закрутить все детали в обратном порядке.
    • Подключить воду и запустить систему.

    Конечно, никто не застрахован от неполадок и сбоев в работе смесителей. Однако все они решаются самостоятельно, без обращения к сантехникам. А полный спектр комплектующих, производящихся на том же заводе, приятно радуют как новичков, так и профессионалов сантехнического дела.

    Отзывы

        Отзывы от продукции фирмы Frap совершенно неоднозначны. Кто-то хвалит за стоимость, но ругает за качество. Другие настаивают на том, что в экономсегменте аксессуаров для сантехники этот китайский производитель является едва ли не лучшим по качественным показателям. Даже профессиональные сантехники склонны к комментариям в пользу смесителя, поскольку они полностью оправдывают свою стоимость. Да, может случиться всякое. Выбрав дорогостоящий аксессуар, можно с ужасом вернуть его в магазин на следующий же день. А можно приобрести самый простой смеситель Frap и радоваться его функциональности, практичности и производительности как минимум 1 год.

        Чаще всего негативные отзывы получают изделия, прослужившие чуть больше гарантийного срока. И это неплохо. По заверениям экспертов, неполадки в первые же дни использования возникают только в случае некорректной установки или наличия заводского брака. В отличие от первой проблемы, вторая решается путем возврата изделия и обмена его на качественную модель.

        Обзор на смеситель для мойки Frap F4128-2 смотрите в видео ниже.

        Frap производитель недорогих качественных смесителей для раковин

        Frap: Фрап

        Страна производитель: Китай

        Компания Haiba (Хайба) крупнейшей производитель сантехнического оборудования, имеет собственную сеть по всему Миру. Торговая марка Frap (Фрап) предлагаемая компанией Haiba, соответствует следующим мировым стандартам:

        CE (Conformite Europeenne) – знак европейского соответствия, дается изделиям соответствующим директивам и стандартам Европейского Союза предъявляемым к продуктам.

        UL (Underwriters Laboratories) – лаборатория по сертификации и стандартизации в области технической безопасности США.

        ISO (ИСО) International (Международная) Organization (организация) for Standardization (по стандартизации) – занимается выдачей стандартов. Так же продукция Frap (Фрап) имеет все необходимые российские сертификаты, зарегистрированный торговый знак.

        Смесители Frap выполнены в современном дизайне, включают в себя последние технические разработки, имеют высокое качество. Frap, предлагает широкую линейку своей продукции, это смесители эконом класса, смесители серии Люкс, аксессуары для ванной, смесители для кухни и для раковин, смесители для ванны, одним словом любой покупатель сможет подобрать для себя необходимую модель, согласно его техническим назначениям и финансовым возможностям.

        Качество начинается с сырья

        Для производства серии Люкс смесителей Frap, используется медное сырье, европейского качества, оно экологически безопасно для здоровья и не имеет токсичных веществ. Сырье отличается высокими показателями прочности и пластичности, что не позволяет изделиям, изготовленным из него трескаться, деформироваться, что в свою очередь может привести к протечкам. Высокое качество используемых материалов в производстве смесителей, дает гарантию долгой службы продукта.

        Технологии Frap

        При отливки продукции используется итальянская технология IMR. В смесители устанавливаются сердечники, делающие поверхность продукта гладкой, блестящей и чистой, так же на поверхности обработанной таким образом практически не нарастают известковые отложения. Благодаря тому, что изделия обрабатываются на японских станках CNC, оборудование Brother, отклонения в размерных показаниях не превышают 0,05 мм.

        Автоматизированное гальваническое нанесение, делает покрытие изделия гладким, идеально ровным и чистым. Изделия не выцветут в течение многих – многих лет. Продукция Frap (Фрап) успешно прошла 200 часовые испытания на прочность в солевом тумане. В аэраторах стоит система насыщения воды кислородом, что снижает затраты воды и делает его менее шумным. Аэратор легко подвергается самостоятельной очистки. В смесителях установлены испанские керамические картриджи, производства Sedal. Все серии проходят испытания на разрыв давлением 2,5 МРА, в свою очередь картриджи тестируются на герметичность. Продукция комплектуется душевыми шлангами, производства Youshi (Xiamen).

        Frap страна производитель, краны фрап

        Frap смесители страна производитель

        Home / Полезные советы / Сантехника / Frap смесители страна производитель

        20.09.2015 Сантехника 16,321 Views

        У некоторых потребителей, которым продавцы рекомендуют приобрести Frap смесители, страна производитель вызывает сомнения в правильности такого выбора. Дело в том, что это сантехническое оборудование изготавливается в Китае. По известным причинам сложилось мнение, что товары из этой страны обладают низким качеством. Однако не стоит категорично отказываться от покупки.

        Смесители Frap

        Потребители, которые внимательно следят за изменениями на мировом рынке, наверняка обратили внимание на то, что товары из Китая уверенно завоевывают свои ниши не только в России, но и в Европе. Причиной роста интереса к этой продукции стали существенные перемены в экономике Китая.

        смеситель для кухни Frap

        В последнее время производители страны отказались от ставки на количество продукции. Сейчас ведущие компании серьезное внимание уделяют качеству товаров. Поэтому, делая выбор смесителя на кухню, в ванную, модели Frap стоит рассмотреть в качестве возможного варианта.

        Добивать хороших результатов китайским компаниям удается при помощи сотрудничества с известными концернами, оснащения заводов импортным оборудованием, применения новейших технологий. Смесители Frap изготавливаются на оборудовании, закупленном у лучших производителей из Италии, в создании изделий используются качественные материалы, что и позволяет им достойно выполнять свои функции.

        Преимущества продукции Frap

        Преимуществ у продукции Frap достаточно, чтобы обратить на них внимание. Смесители отличаются:

        • Доступной стоимостью
        • Обширным ассортиментом
        • Достойным качеством

        смеситель Frap для ванной

        Низкие цены являются первым привлекательным фактором для большинства потребителей. Действительно покупка смесителя не разорит семейный бюджет. Не менее привлекателен большой ассортимент моделей. В модельном ряду Frap можно легко выбрать смеситель в ванную и на кухню с учетом дизайнерского стиля, особенностей сантехнического оборудования. В способности китайцев идеально имитировать известную продукцию никто не сомневается. Но есть в ассортименте и оригинальные модели в ретро стиле, с рычагом в виде пожарного гидранта или корабельной пушки, смесители со стеклянным изливом, с сенсорным датчиком и т.д. В модельном ряду есть изделия хромированные и не хромированные латунные с медным оттенком.

        Отзывы:

        Оля, Питер. Ремонт кухни с мужем делали в прошлом году. В запланированную сумму не удалось уложиться, отделочные материалы решили купить более стильные, чтобы получился идеальный результат. Покупать сантехнику пришли в надежный магазин, где часто делаем небольшие покупки. Продавцу объяснили, что хотелось бы купить надежный, но не особо дорогой смеситель. Он посоветовал Frap, сказал, что, хотя и сделан он в Китае, качество у него хорошее. Поверили, установили. Оказалось, действительно китайцы научились делать приличный товар. У нас однорычажная модель. Отлично работает уже более полугода, никаких претензий.

        Татьяна, Псков. Приобрели смесители Frap в ванну и раковину. Привлек красивый внешний вид, да и цена понравилась. Меня удивило, что размеры смесителей небольшие, а вес у них чувствительный. Муж объяснил, что это как раз плюс. То, что они тяжелые говорит о том, что внутренности у смесителей из латуни, значит, долговечные. Пользоваться ими удобно, напор, температура легко регулируется, ручка удобная. Со времени установки прошло чуть больше 8-ми месяцев, пока ремонтом не приходилось заниматься.

        Катя, Ставрополь. Мы переехали в новую квартиру, где пришлось заменить оба смесителя на кухне и в ванной. Если честно, мне внешний вид моделей Frap очень понравился, уговорила мужа купить, хотя он и возражал. Через 2 месяца после установки мы столкнулись с первой проблемой, в смесителе ванной начала протекать вода около гайки, которая находится на эксцентрике. Кухонный кран еще работает, но настраивать нужную температуру сложно. Лучше бы мужа послушала.

        Поделиться ссылкой:

        Share

        Check Also

        Как выбрать смеситель для ванной с душем

        Содержание: 1. Конструкции смесителей 2. Правила выбора смесителей Знать о том, как выбрать смеситель …

        © Copyright 2019 Сайт о ремонте квартир и другие полезные советы.
        Ремонт в квартире своими руками
        Все материалы на сайте носят исключительно ознакомительный характер. Редакция проекта vceremont.ru не несет ни прямой ни косвенной ответственности за ущерб или убытки, возникающие или якобы возникшие в связи с использованием информации предоставленной на сайте vceremont.ru.

        ВольноГрад

        Свобода общения взрослых людей без запретных тем

        Пропустить

        Chat & Support

        Ремонт смесителя FRAP. Замена картриджа.

        Материалы и технологии
        для бытового строительного ремонта
        квартир, дач, гаражей
        Первое новое сообщение • 2 сообщения • Страница 1 из 1 ОлеГр Сообщения: 179 Зарегистрирован: 2016-10-14 21:33:07

        Ремонт смесителя FRAP.

        Замена картриджа.
        • Пожаловаться на это сообщение
        • Цитата

        Непрочитанное сообщение ОлеГр » 2017-06-19 20:30:42

        01. Отключить воду вентилями.
        02. Снять ручку открутив винтик шестигранником на 2,5.

        03. Открутить аккуратно руками декоративную полусферу.
        Если заросла, залить изнутри по периметру резьбы уксусом.

        04. Гаечным ключом открутить гайку картриджа. Вынуть старый картридж.
        05. Зачистить посадочное место картриджа от отложений.
        06. Вставить новый картридж.
        Закрутить гайку без фанатизма, чтобы остался запас на будущий подтяг.
        07. Включить воду вентилями.
        Убедиться в отсутствии течи и в легком управлении водой двигая рукой ручку картриджа (без декоративной ручки).
        Отрегулировать затяг гайки, чтобы течи не было, а шток картриджа легко двигался рукой.
        08. Декоративное кольцо одел на ФУМ без затяга, чтобы легче снять в следующий раз.
        09. Одеть ручку. Винтик не завинчивал. Если болтается, можно подложить лепесток ФУМ.
        10. Воткнуть декоративную заглушку винта с указателями гор. и хол. воды. Циклоп Сообщения: 62 Зарегистрирован: 2016-10-12 18:08:37

        Re: Ремонт смесителя FRAP. Замена картриджа.

        • Пожаловаться на это сообщение
        • Цитата

        Непрочитанное сообщение Циклоп » 2017-06-21 12:11:08

        ОлеГр :Открутить аккуратно руками декоративную полусферу.
        Если заросла, залить изнутри по периметру резьбы уксусом.
        Точно, уксус хорошо работает. WD40 — не сработает — не механическое трение.
        Один раз намучался раздирать, с тех пор тоже ручку не привинчиваю, а когда мою смесители от пятен, заодно снимаю ручку и чуть откручивают — закручиваю декоративную полусферу. Заодно смотрю — не началась ли протечка из под картриджа. Её ведь сначала долго не видно, вода сочится медленно, стоит в углублении и резьба зарастает. Пока ручка одета не заметишь. Редкие капли из-под ручки теряются среди общего забрызга. К тому моменту, когда вода начинает бежать капелью, проходят месяца и вся резьба вокруг картриджа давно заросла отложениями.
        Такой нарост растворить очень сложно и есть риск при откручивании деформировать или разорвать очень тонкую декоративную полусферу. 2 сообщения • Страница 1 из 1

        Вернуться в «СТРОИТЕЛЬСТВО, РЕМОНТ, ОТДЕЛКА»

        Перейти

        • НаукоГрад
        • Лаборатория БУДУЩЕГО
        • Подростково — молодёжный клуб МЕТАМОРФОЗА
        • Стадион Тьюринга
        • АПОКАЛИПСИС
        • МЕРЦАНИЕ
        • Школьный двор
        • Физика и Математика
        • Язык и Литература
        • Органика и Биология
        • Общество, история, география
        • Школа изнутри
        • Отношения, дружба, любовь
        • Медосмотры и секс
        • Деньги, бизнес, профессия
        • Наркоманы и хулиганы
        • Студенческий городок.
        • Общага
        • Ночной клуб «Эрогенная зона»
        • IT-лабиринт WWW.ПАУТИНА
        • CLOUD
        • SocNET
        • WINDOWS
        • Apple iOS
        • ANDROID
        • Linux Ubuntu
        • Лаборатория Сороки
        • Закрытый ПСИ-центр манипуляций СОЗНАНИЕМ
        • Лаборатория СЕКСА и СЕКСоПАТОЛОГИИ
        • Исследовательский центр НЕВЕДОМОГО и НЕПОНЯТНОГО
        • Библиотека
        • СМИ РЕЗОНАНС
        • РОССИЯ и проРоссийский взгляд
        • ВЛАСТЬ
        • АРМИЯ
        • ЭКОНОМИКА
        • КУЛЬТУРА
        • E-RU
        • ОППОЗИЦИЯ
        • США и проАмериканский взгляд
        • ТРЕТЬЯ СИЛА
        • КИТАЙ
        • ИСЛАМское сопротивление
        • ГеоПолитика. Глобальные ВОЙНЫ и КОНФЛИКТЫ
        • WW3
        • США vs РОССИЯ
        • УКРАИНА
        • НОВОРОССИЯ
        • КРЫМ и СЕВАСТОПОЛЬ
        • СИРИЯ
        • КУРДИСТАН
        • WW2
        • WW2/ВОВ
        • WW1
        • РЕВОЛЮЦИЯ vs ЭВОЛЮЦИЯ
        • АРМЕНИЯ
        • ЧЕЛОВЕК и ПРИРОДА
        • Гражданское ОБЩЕСТВО
        • ОБЩЕСТВО
        • Агенство РЕЙТИНГ
        • Поле БИТВ и СРАЖЕНИЙ
        • ВОЙНА и ДЕТИ
        • ЗАВОДСКОЙ район
        • МАСТЕРСКАЯ
        • ИНСТРУМЕНТ
        • СТРОИТЕЛЬСТВО, РЕМОНТ, ОТДЕЛКА
        • КОМПЬЮТЕРЫ, СВЯЗЬ, БЕЗОПАСНОСТЬ
        • WebMaster
        • Чайная «УСПЕХ»
        • Микрорайон ЗДОРОВЬЕ
        • МЕДСАНЧАСТЬ
        • Клуб Лавандовая лента (ОНКОЛОГИЯ)
        • Остров УВЛЕЧЕНИЙ
        • Клуб МЕДИА (ФОТО АУДИО ВИДЕО)
        • Media HARD
        • Media SOFT
        • Art IDEA
        • МикроМир Макрушников
        • ЗооПарк, Ботанический сад, Аквариум
        • Замок ХОББИтов
        • СПАЛЬНЫЙ район
        • ДОМ и СЕМЬЯ
        • РОДИТЕЛИ и ДЕТИ
        • КУХНЯ
        • АТЕЛЬЕ
        • ЖКХ
        • Парк РОМАНТИКА
        • Парк развлечений ПОЗИТИВ
        • ИГРОВАЯ площадка
        • ЛАВКА на окраине
        • ПОЛИГОН
        • Лаборатория TESTеров
        • АДМИНИСТРАТИВНЫЙ округ
        • НОВОСТИ ВольноГрада
        • ПРАВИЛА жизни ВольноГрада
        • 112 — СКОРАЯ ПОМОЩЬ
        • FAQ
        • Часовой пояс: UTC+04:00
        • Удалить cookies конференции
        • Наша команда

        Смесители Frap: разновидности и отличительные черты

        Устройства Frap не так давно появились на отечественном рынке. Смесители отличаются разновидностями и отличительными чертами. Производитель Frap – китайский, хотя его продукция такая же качественная, как и аналогичные товары европейских брендов. Стоит разобраться в особенностях, положительных и отрицательных свойствах популярных моделей от компании Frap.

        Особенности

        Смесители Frap среди прочих представителей от других компаний обладают одной главной чертой – продукция является бюджетной. Фирма предлагает люксовые модели по цене, соизмеримой со стоимостью средних по цене вариантов моделей европейского производителя. Производство основных линеек компании находится в Китае. Страна-производитель предлагает продукцию фабричного качества. Эти изделия считаются надежными, если сравнивать с теми, что производятся кустарно.

        Кроме смесителей, производитель Frap предлагает потребителю недорогую, но качественную сантехнику, детали для соединения труб, а также полезные аксессуары для ванной комнаты. Сантехника этой торговой марки известна широкой публике под названиями Ledeme и Gappo.

        Что касается смесителей Frap, то эта категория товаров сертифицирована в РФ, а также во многих европейских странах. Продукция компании охотно покупается и в Америке. Недорогие смесители пользуются популярностью в разных странах, так как схожи по характеристикам с моделями известных производителей.

        Оригинальных изделий собственной линейки компания предлагает немного. Внешний вид устройств современный. Китайский производитель предлагает большое количество вариантов стилизованного оформления изделий. Главное же преимущество приборов – это экономичность. Это качество проявляется в возможности экономии как на самых смесителях, так и на расходе воды.

        Кстати, маркетологи, работающие с китайскими устройствами, говорят, что низкая стоимость обуславливается оптимизацией производственных процессов, а не низкой себестоимостью используемых материалов. Хотя если рассматривать самые дешевые изделия фирмы, то используемые сплавы в изделиях действительно бюджетные. Нержавеющая сталь в этих устройствах не присутствует. В производственных процессах чаще участвует латунь с оптимально подходящими недорогими сплавами. Название используемой в производстве основы для сплавов – это силумин.

        Плюсы и минусы

        Основное преимущество смесителей – это, конечно же, экономичность. Кроме того, что сами изделия очень дешевые, они еще и имеют оснащение, способное сэкономить водные ресурсы. Вся продукция хоть и китайского производства, но имеет соответствующие сертификаты и лицензии государств, в которые идет на экспорт. Производитель обеспечивает полное гарантийное обслуживание продукции в соответствии с гарантийными сроками, указанными в сопроводительной документации.

        Еще одно достоинство продукции – это многообразие форм, стилистических оформлений, цветовых решений. Многие модели этого предприятия полностью повторяют аналогичные европейские модели. Разнообразные варианты смесителей Frap позволяют потребителю выбрать нужный для себя вариант. Например, есть гибкий смеситель для раковины, который обеспечит максимальное давление. А также есть классические Г-образные модели, различающиеся видом трубки. Она может быть круглой, квадратной или даже треугольной.

        Из бюджетных вариантов покупатели отмечают модели линейки Gappo и Frud. Вообще, китайский производитель предлагает несколько видов смесителей. При выборе важно учитывать варианты установки. К примеру, модели бывают подходящими для ванной или кухни. Разделение назначения важно, так как материалы изготовления изделий могут различаться. Выбранный не к месту вариант получит преждевременный износ.

        Из недостатков пользователи отмечают довольно быстрый износ таких деталей смесителей, как прокладки и маховики. А также на хромированных моделях остаются капли воды, при этом они плохо отмываются. Некоторые недостатки можно свести к минимуму, например, изношенные детали легко заменить на новые самостоятельно.

        Виды

        Основные виды смесителей Frap включают несколько вариантов.

        • Классический смеситель с двумя маховиками – это идеальный вариант для традиционных моделей. Двумя кранами удобно регулировать температуру. Вентили проворачиваются вполоборота, имеют интересную форму. Классические модели подразделяются на варианты для мойки и для монтажа на стену.
        • Некоторые смесители классического типа оборудуются джойстиком. Этот вариант не снабжается маховиками. Он имеет один рычаг, который для включения воды нужно повернуть вверх, а для выключения – вниз. Удобство в эксплуатации таких моделей заключается в том, что включать или выключать кран можно одной рукой.
        • Еще комфортнее пользоваться классическими сенсорными моделями. Смесители с сенсорным датчиком легко настроить под желаемую мощность потока и температуру воды.
        • Если при использовании важно, чтобы температура воды поддерживалась в заданном состоянии, то подойдут модели, оснащенные термостатом.
        • Удобны смесители, оснащенные силиконовой лейкой, а также каскадный вариант с несколькими кранами разного уровня.

        Популярные модели

        Классическое разделение вариантов китайских смесителей выглядит следующим образом:

        • для кухни;
        • для ванной.

        В первой категории моделей к популярным можно отнести варианты: F4909 и F4927. Это классические двухвентильные смесители с хромированным покрытием. Высокий излив идеально подходит для раковины на кухне. Варианты снабжены стандартным аэратором. Вид изделия имеют классический.

        Среди изделий современного типа популярен вариант для умывальника F10703-B. Это однорычажная модель, без маховиков, компактная. Она будет уютно выглядеть как в ванной комнате, так и на кухне. Специалисты рекомендуют выбирать ее для ванной, так как для кухни она может оказаться низкой.

        Высокой популярностью пользуются смесители сенсорного типа F512-1 и F511. Модели оснащены термостатом, имеют традиционную форму излива, идеальны для умывальника. Излив привлекает внимание хромированным покрытием. Сенсор инфракрасного типа питается как от сети, так и дополнительно от батареек. Цена на устройство довольно демократичная, так как поворотного механизма в нем нет, встроенный фильтр отсутствует, обратного клапана нет. Ассортимент разнообразен цветовыми решениями.

        В продаже можно найти модели в следующих цветовых исполнениях:

        • белый;
        • черный;
        • песочный;
        • полированный;
        • матовый.

        Если в санузел нужны более привычные варианты с оснащением в виде стандартного поворотного механизма, то лучше рассмотреть модели G2245 и F3014. Дополнительный поворотный механизм позволяет переключать воду с крана на душ. Этот механизм удобен для регулировки одной рукой. При выборе вариантов стоит иметь в виду, что даже самые дорогие и качественные модели не будут работать при неправильной установке и несоблюдении инструкций по эксплуатации.

        Установка

        Замена старого или установка нового смесителя в ванной, на умывальник – это занятие не столь сложное, как может показаться на первый взгляд. Не всегда для ее выполнения нужно обязательно вызывать сантехника. Обычно модели, поставляемые на российский рынок, обеспечиваются подробной инструкцией на русском языке. В установке простейших моделей поможет изучение подробного руководства. Если раковина, для которой планируется установить смеситель, уже имеется, нужно посчитать количество отверстий, предусмотренных производителем. Подобное же количество комплектующих должно быть в составе к смесителю.

        Установка устройства при наличии всех инструментов и составляющих займет всего около получаса.

        Всю работу можно условно разделить на такие этапы, как:

        • подготовка места;
        • монтаж устройства;
        • подключение.

        В ходе подготовительных работ в первую очередь нужно пропустить гибкие шланги через соответствующие отверстия в раковине. Потом к этим шлангам нужно прикрутить излив, применяя соответствующий инструмент. Внизу смесителя должен присутствовать уплотнитель, который исключит образование течи. Затем в монтажные дырочки смесителя нужно вставить так называемые штыри. Их число может изменяться ввиду разницы в типе изделий. Помимо резиновой прокладки, в изделиях обязательно присутствует металлическая пластина. Она надевается поверх прокладки и помогает лучшей фиксации изделия.

        Впоследствии гибкие шланги подключаются к имеющимся трубам. В местах подключений также должны присутствовать прокладки, а с трубами изделия соединяются накидными гайками. После подключения можно проверить качество смесителя. Следует открыть подачу воды, а затем внимательно осмотреть все соединители. Если они сухие, значит, установка смесителя прошла успешно.

        Следует быть внимательным при установке устройства с гигиеническим душем. В бюджетных изделиях гибкие трубки, как правило, бывают не самого лучшего качества. Соединительные детали часто деформируются при использовании. Специалисты советуют сразу заменять их подводами в металлической обмотке. Кстати, не всегда при поломке старого смесителя обязательно устанавливать новый.

        Ремонт

        Некоторые модели китайского производителя настолько просты, что их легко отремонтировать. Например, однорычажные варианты с картриджем не подвергаются ржавчине, не боятся негативного действия. Преждевременное разрушение этих устройств может возникнуть из-за воды плохого качества. Чтобы лучше понять процесс ремонта, стоит разобрать устройство на составляющие запчасти, желательно своими руками.

        Каждый смеситель этого вида обязательно включает следующие детали:

        • рычаг, которым регулируется вода;
        • регулировочный штырь, на который закрепляется рычажок;
        • корпус с шарниром внутри; вместо клапана может присутствовать картридж из пластика с керамическими внутренностями;
        • кольцо;
        • регулировочная манжета;
        • дивертор.

        Частой причиной выхода из строя керамических картриджей может служить мелкий сор, попавший в водопроводную систему. Если в качестве основной детали, распределяющей воду, выступает стальной шар, то он со временем может заржаветь. Для нормальной работы устройства часто достаточно произвести замену изношенных деталей.

        Иногда течь в кране может образоваться из-за деформации резиновых уплотнителей. Эта поломка может возникнуть из-за плохо затянутой прижимной гайки. Протекание можно быстро устранить при помощи герметика. Это средство поможет справиться с проблемой временно, если купить новое изделие не представляется возможным.

        Чтобы отремонтировать внутренние части смесителя, для начала его нужно снять. Фиксирующий винт можно найти под декоративной заглушкой, на которой обычно расположены точки горячее и холодное. При откручивании винта стоит снять сам рычаг. Здесь требуется предельная аккуратность, иначе конструкция легко повреждается. При снятии рычага откроется еще одна декоративная деталь, а под ней расположена прижимная гайка.

        Далее, действия будут отличаться от внутренностей смесителя – распределительный шар или картридж. В первом варианте стоит проверить общий вид самого шара, состояние резинок и удерживающих пружин. Каждый из этих элементов можно заменить новыми по отдельности.

        Если внутри картридж, его просто нужно аккуратно вытащить, направиться в торговую точку сантехники, где приобрести другой элемент. Резиновые уплотнители, находящиеся под картриджем, обычно редко приходят в негодность. Для качественного ремонта бывает достаточно удалить из-под них грязь.

        Отзывы

        Отзывы о смесителях этой торговой марки разные. Чаще всего пользователи жалуются на протечки, возникающие в процессе эксплуатации. Сантехники советуют сравнивать отрицательные отзывы на разных площадках. В большинстве случаев негативные мнения касаются лишь одного процента изделий от количества всех продаваемых изделий. Кроме того, профессионалы утверждают, что те, кто установил смесители Frap и пользуется успешно, редко идет писать хвалебные отзывы.

        Впечатлениями в интернете, как правило, делятся либо профессиональные блогеры, либо те, кто столкнулся с серьезной проблемой. Профессионалы как раз рекомендуют изделия китайского производителя, так как в большей части эти люди отдают предпочтение именно недорогим и качественным изделиям от проверенных торговых марок.

        В следующем видео вас ждет обзор смесителя Frap F4053 с гибким изливом.

        Популярные записи

        • Полка в прихожую

          В настоящее время существует огромное количество самых разнообразны вариантов полок в прихожую, причем это напрямую…

        • Утепление пола в деревянном

          Утепление пола в деревянном доме снизу: материалы и технология монтажа ПОДЕЛИТЕСЬВ СОЦСЕТЯХ Одной из распространенных…

        модели для раковины и ванны, страна-производитель изделий, новинки от фирмы-2021, отзывы сантехников

        Устройства Frap не так давно появились на отечественном рынке. Смесители отличаются разновидностями и отличительными чертами. Производитель Frap – китайский, хотя его продукция такая же качественная, как и аналогичные товары европейских брендов. Стоит разобраться в особенностях, положительных и отрицательных свойствах популярных моделей от компании Frap.

        Особенности

        Смесители Frap среди прочих представителей от других компаний обладают одной главной чертой – продукция является бюджетной. Фирма предлагает люксовые модели по цене, соизмеримой со стоимостью средних по цене вариантов моделей европейского производителя. Производство основных линеек компании находится в Китае. Страна-производитель предлагает продукцию фабричного качества. Эти изделия считаются надежными, если сравнивать с теми, что производятся кустарно.

        Кроме смесителей, производитель Frap предлагает потребителю недорогую, но качественную сантехнику, детали для соединения труб, а также полезные аксессуары для ванной комнаты. Сантехника этой торговой марки известна широкой публике под названиями Ledeme и Gappo.

        Что касается смесителей Frap, то эта категория товаров сертифицирована в РФ, а также во многих европейских странах. Продукция компании охотно покупается и в Америке. Недорогие смесители пользуются популярностью в разных странах, так как схожи по характеристикам с моделями известных производителей.

        Оригинальных изделий собственной линейки компания предлагает немного. Внешний вид устройств современный. Китайский производитель предлагает большое количество вариантов стилизованного оформления изделий. Главное же преимущество приборов – это экономичность. Это качество проявляется в возможности экономии как на самых смесителях, так и на расходе воды.

        Кстати, маркетологи, работающие с китайскими устройствами, говорят, что низкая стоимость обуславливается оптимизацией производственных процессов, а не низкой себестоимостью используемых материалов. Хотя если рассматривать самые дешевые изделия фирмы, то используемые сплавы в изделиях действительно бюджетные. Нержавеющая сталь в этих устройствах не присутствует. В производственных процессах чаще участвует латунь с оптимально подходящими недорогими сплавами. Название используемой в производстве основы для сплавов – это силумин.

        Плюсы и минусы

        Основное преимущество смесителей – это, конечно же, экономичность. Кроме того, что сами изделия очень дешевые, они еще и имеют оснащение, способное сэкономить водные ресурсы. Вся продукция хоть и китайского производства, но имеет соответствующие сертификаты и лицензии государств, в которые идет на экспорт. Производитель обеспечивает полное гарантийное обслуживание продукции в соответствии с гарантийными сроками, указанными в сопроводительной документации.

        Еще одно достоинство продукции – это многообразие форм, стилистических оформлений, цветовых решений. Многие модели этого предприятия полностью повторяют аналогичные европейские модели. Разнообразные варианты смесителей Frap позволяют потребителю выбрать нужный для себя вариант. Например, есть гибкий смеситель для раковины, который обеспечит максимальное давление. А также есть классические Г-образные модели, различающиеся видом трубки. Она может быть круглой, квадратной или даже треугольной.

        Из бюджетных вариантов покупатели отмечают модели линейки Gappo и Frud. Вообще, китайский производитель предлагает несколько видов смесителей. При выборе важно учитывать варианты установки. К примеру, модели бывают подходящими для ванной или кухни. Разделение назначения важно, так как материалы изготовления изделий могут различаться. Выбранный не к месту вариант получит преждевременный износ.

        Из недостатков пользователи отмечают довольно быстрый износ таких деталей смесителей, как прокладки и маховики. А также на хромированных моделях остаются капли воды, при этом они плохо отмываются. Некоторые недостатки можно свести к минимуму, например, изношенные детали легко заменить на новые самостоятельно.

        Виды

        Основные виды смесителей Frap включают несколько вариантов.

        • Классический смеситель с двумя маховиками – это идеальный вариант для традиционных моделей. Двумя кранами удобно регулировать температуру. Вентили проворачиваются вполоборота, имеют интересную форму. Классические модели подразделяются на варианты для мойки и для монтажа на стену.
        • Некоторые смесители классического типа оборудуются джойстиком. Этот вариант не снабжается маховиками. Он имеет один рычаг, который для включения воды нужно повернуть вверх, а для выключения – вниз. Удобство в эксплуатации таких моделей заключается в том, что включать или выключать кран можно одной рукой.
        • Еще комфортнее пользоваться классическими сенсорными моделями. Смесители с сенсорным датчиком легко настроить под желаемую мощность потока и температуру воды.
        • Если при использовании важно, чтобы температура воды поддерживалась в заданном состоянии, то подойдут модели, оснащенные термостатом.
        • Удобны смесители, оснащенные силиконовой лейкой, а также каскадный вариант с несколькими кранами разного уровня.

        Популярные модели

        Классическое разделение вариантов китайских смесителей выглядит следующим образом:

        • для кухни;
        • для ванной.

        В первой категории моделей к популярным можно отнести варианты: F4909 и F4927. Это классические двухвентильные смесители с хромированным покрытием. Высокий излив идеально подходит для раковины на кухне. Варианты снабжены стандартным аэратором. Вид изделия имеют классический.

        Среди изделий современного типа популярен вариант для умывальника F10703-B. Это однорычажная модель, без маховиков, компактная. Она будет уютно выглядеть как в ванной комнате, так и на кухне. Специалисты рекомендуют выбирать ее для ванной, так как для кухни она может оказаться низкой.

        Высокой популярностью пользуются смесители сенсорного типа F512-1 и F511. Модели оснащены термостатом, имеют традиционную форму излива, идеальны для умывальника. Излив привлекает внимание хромированным покрытием. Сенсор инфракрасного типа питается как от сети, так и дополнительно от батареек. Цена на устройство довольно демократичная, так как поворотного механизма в нем нет, встроенный фильтр отсутствует, обратного клапана нет. Ассортимент разнообразен цветовыми решениями.

        В продаже можно найти модели в следующих цветовых исполнениях:

        • белый;
        • черный;
        • песочный;
        • полированный;
        • матовый.

        Если в санузел нужны более привычные варианты с оснащением в виде стандартного поворотного механизма, то лучше рассмотреть модели G2245 и F3014. Дополнительный поворотный механизм позволяет переключать воду с крана на душ. Этот механизм удобен для регулировки одной рукой. При выборе вариантов стоит иметь в виду, что даже самые дорогие и качественные модели не будут работать при неправильной установке и несоблюдении инструкций по эксплуатации.

        Установка

        Замена старого или установка нового смесителя в ванной, на умывальник – это занятие не столь сложное, как может показаться на первый взгляд. Не всегда для ее выполнения нужно обязательно вызывать сантехника. Обычно модели, поставляемые на российский рынок, обеспечиваются подробной инструкцией на русском языке. В установке простейших моделей поможет изучение подробного руководства. Если раковина, для которой планируется установить смеситель, уже имеется, нужно посчитать количество отверстий, предусмотренных производителем. Подобное же количество комплектующих должно быть в составе к смесителю.

        Установка устройства при наличии всех инструментов и составляющих займет всего около получаса.

        Всю работу можно условно разделить на такие этапы, как:

        • подготовка места;
        • монтаж устройства;
        • подключение.

        В ходе подготовительных работ в первую очередь нужно пропустить гибкие шланги через соответствующие отверстия в раковине. Потом к этим шлангам нужно прикрутить излив, применяя соответствующий инструмент. Внизу смесителя должен присутствовать уплотнитель, который исключит образование течи. Затем в монтажные дырочки смесителя нужно вставить так называемые штыри. Их число может изменяться ввиду разницы в типе изделий. Помимо резиновой прокладки, в изделиях обязательно присутствует металлическая пластина. Она надевается поверх прокладки и помогает лучшей фиксации изделия.

        Впоследствии гибкие шланги подключаются к имеющимся трубам. В местах подключений также должны присутствовать прокладки, а с трубами изделия соединяются накидными гайками. После подключения можно проверить качество смесителя. Следует открыть подачу воды, а затем внимательно осмотреть все соединители. Если они сухие, значит, установка смесителя прошла успешно.

        Следует быть внимательным при установке устройства с гигиеническим душем. В бюджетных изделиях гибкие трубки, как правило, бывают не самого лучшего качества. Соединительные детали часто деформируются при использовании. Специалисты советуют сразу заменять их подводами в металлической обмотке. Кстати, не всегда при поломке старого смесителя обязательно устанавливать новый.

        Ремонт

        Некоторые модели китайского производителя настолько просты, что их легко отремонтировать. Например, однорычажные варианты с картриджем не подвергаются ржавчине, не боятся негативного действия. Преждевременное разрушение этих устройств может возникнуть из-за воды плохого качества. Чтобы лучше понять процесс ремонта, стоит разобрать устройство на составляющие запчасти, желательно своими руками.

        Каждый смеситель этого вида обязательно включает следующие детали:

        • рычаг, которым регулируется вода;
        • регулировочный штырь, на который закрепляется рычажок;
        • корпус с шарниром внутри; вместо клапана может присутствовать картридж из пластика с керамическими внутренностями;
        • кольцо;
        • регулировочная манжета;
        • дивертор.

        Частой причиной выхода из строя керамических картриджей может служить мелкий сор, попавший в водопроводную систему. Если в качестве основной детали, распределяющей воду, выступает стальной шар, то он со временем может заржаветь. Для нормальной работы устройства часто достаточно произвести замену изношенных деталей.

        Иногда течь в кране может образоваться из-за деформации резиновых уплотнителей. Эта поломка может возникнуть из-за плохо затянутой прижимной гайки. Протекание можно быстро устранить при помощи герметика. Это средство поможет справиться с проблемой временно, если купить новое изделие не представляется возможным.

        Чтобы отремонтировать внутренние части смесителя, для начала его нужно снять. Фиксирующий винт можно найти под декоративной заглушкой, на которой обычно расположены точки горячее и холодное. При откручивании винта стоит снять сам рычаг. Здесь требуется предельная аккуратность, иначе конструкция легко повреждается. При снятии рычага откроется еще одна декоративная деталь, а под ней расположена прижимная гайка.

        Далее, действия будут отличаться от внутренностей смесителя – распределительный шар или картридж. В первом варианте стоит проверить общий вид самого шара, состояние резинок и удерживающих пружин. Каждый из этих элементов можно заменить новыми по отдельности.

        Если внутри картридж, его просто нужно аккуратно вытащить, направиться в торговую точку сантехники, где приобрести другой элемент. Резиновые уплотнители, находящиеся под картриджем, обычно редко приходят в негодность. Для качественного ремонта бывает достаточно удалить из-под них грязь.

        Отзывы

        Отзывы о смесителях этой торговой марки разные. Чаще всего пользователи жалуются на протечки, возникающие в процессе эксплуатации. Сантехники советуют сравнивать отрицательные отзывы на разных площадках. В большинстве случаев негативные мнения касаются лишь одного процента изделий от количества всех продаваемых изделий. Кроме того, профессионалы утверждают, что те, кто установил смесители Frap и пользуется успешно, редко идет писать хвалебные отзывы.

        Впечатлениями в интернете, как правило, делятся либо профессиональные блогеры, либо те, кто столкнулся с серьезной проблемой. Профессионалы как раз рекомендуют изделия китайского производителя, так как в большей части эти люди отдают предпочтение именно недорогим и качественным изделиям от проверенных торговых марок.

        В следующем видео вас ждет обзор смесителя Frap F4053 с гибким изливом.

        Кухонный смеситель FRAP F-4101 по низкой цене в Российской сантехнике

        Технические характеристики Frap H01 на шпильке (F4101)

        Артикул

        F4101

        Коллекция

        H01

        Тип

        смеситель

        Назначение

        для кухонной мойки

        Встроенные системы

        нет

        Тип управления

        однорычажное

        Тип монтажа

        на мойку; на столешницу

        Механизм

        керамический картридж

        Механизм скрытого монтажа

        не предусмотрен

        В комплекте с душем (лейкой)

        без душа

        Тип излива

        поворотный

        Выдвижной излив

        нет

        Высота излива

        260 мм

        Длина излива

        220 мм

        Каскадный излив

        нет

        Количество монтажных отверстий

        1

        Подключение фильтра

        нет

        Переключатель на стиральную/посудомоечную машину

        нет

        Стиль

        современный стиль (Hi-Tech)

        Цвет

        хром

        Гарантия

        12 мес

        Страна происхождения бренда

        Китай

        Цвет производителя

        хром

        Отзыв

        Оставить отзыв

        Заводской Артикул: F-4101

        гарантия производителя. мес: 12

        Характеристики смесителя

        Производитель смесителя: Frap

        Назначение смесителя: для кухонной мойки

        Тип смесителя: однорычажный

        Запорный клапан: керамический картридж

        Материал корпуса: латунь

        Монтаж смесителя: на горизонтальную поверхность

        Поворотный излив: да

        Нагрев воды: нет

        Цвет смесителя: хром

        Покрытие: хром

        Выдвижной излив: нет

        Присоединительный размер: 1/2″

        Тип подводки: гибкая

        Смеситель для кухни FRAP F4966 хром

        Описание

        Смеситель для кухни FRAP (Фрап) F4966 хром в современном стиле.

        Монтаж: на одно отверстие.

        Особенности

        • Керамический картридж FRAP (Фрап) Ø40 мм
        • Аэратор FRAP (Фрап)
        • Поворотный излив 25 см
        • На гайке

        В комплекте

        • Гибкая подводка ½ — 30 см

        Особенности

        Вращение излива : 

        Поворотный

        Управление : 

        Однорычажное

        Форма излива : 

        Традиционная

        Бренд  ? : 

        FRAP

        Коллекция : 

        H66

        Бренд страна :  Страна производства :  Стилистика дизайна : 
        • Современный стиль

        Сантехника Frap успешно зарекомендовала себя на российском рынке. Производство этой компании находится в Китае, за годы своего существования она доказала, что продукция вполне соответствует европейским стандартам.

        FRAP  занимает одно из лидирующих мест среди ведущих китайских производителей сантехнического оборудования благодаря таким важным факторам как широкий ассортимент продукции, оптимальное соотношение цены и высокого качества.

        Смесители Frap производятся на итальянском оборудовании, но на территории Китая.

        Большой выбор смесителей позволят вам подобрать вариант под любой интерьер ванной комнаты.

        Дизайн смесителей  Frap не уступает более дорогим аналогам и при этом  соответствует европейским стандартам по экономии воды. Производитель  имеет все необходимые сертификаты и лицензии во многих странах, в том числе и России. Сервисное обслуживание и ремонт во время гарантийного срока обеспечиваются производителем.

        Этот широко известный производитель высококачественной бытовой сантехники, уже более 15-ти лет реализует свою продукцию на мировом рынке. За этот сравнительно небольшой для крупных производителей срок компания достигла немалых результатов.  Одних только смесителей  Frap производится и реализуется свыше шести миллионов единиц! Количественные показатели продукции совсем не уступают показателям качества.  Смесители Frap  отличаются надежностью, износостойкостью, простотой сборки и установки, удобством в эксплуатации, красивым дизайном и, конечно же, приемлемой ценой.

        Смесители Frap производятся нескольких типов: 
        — классические варианты с двумя вентилями. 
        Они прекрасно подойдут для тех, кто отдает предпочтение традициям. Напор и температура воды регулируется с помощью двух кранов. 
        Один из них отвечает за холодную воду,  другой — за горячую.

        — смесители  однорычажные. 
        Напор изменяется при движении рычага вверх или вниз. А температура — при повороте рычага влево или вправо.
        Как утверждают отзывы, смесители «Фрап» данного вида очень удобны в эксплуатации. Они позволяют регулировать поток воды одной рукой.

        — сенсорные смесители являются лидерами по комфорту использования. 
        Имеется сенсорный датчик, благодаря которому настраивается желаемая температура и мощность потока.

        — с термостатическими датчиками. 
        Данный смеситель способен поддерживать заданное значение температуры независимо от температуры воды в водопроводе или изменения напора.

        Элементы рулевого управления и подвески для легковых автомобилей: проектирование и производство

        div # contenuto_419185 .immagini-ricerca-catalogo> div {font-size: 10px}} @ media screen и (min-width: 1200px) {}]]>

        ПОЛНЫЙ АССОРТИМЕНТ ПРОИЗВОДИТЕЛЬ OE
        С 1932 года! FRAP олицетворяет качество, эффективность и инновации. .

        FRAP: Жесткие и надежные автомобильные детали.

        Английская аббревиатура, указывающая на наш международный охват.

        Свирепость: указывает на жестокость нашего происхождения, но также и на Свирепость в нашем стремлении к совершенству.
        Надежность: символизирует прочность и качество конструкции наших компонентов, что позволяет нам занимать лидирующие позиции на международной арене.
        Automotive Parts: потому что на протяжении более 85 лет мы можем соответствовать и превосходить самые высокие стандарты автомобильной промышленности.

        FRAP — это история, идущая в ногу со временем, с оглядкой в ​​будущее благодаря непрерывным исследованиям на протяжении более 85 лет. Опыт, пришедший издалека, страсть, которая смогла возобновиться и расцвести.

        Мы всегда участвовали в проектировании , производстве и разработке автомобильных компонентов : рычагов подвески и шарниров, шаровых шарниров, рулевых головок, рулевых тяг и других компонентов.

        Компоненты безопасности для автомобилей и транспортных средств с управляемыми мостами являются частью все более специализированного сектора, который требует постоянного технического развития и постоянного контроля, чтобы соответствовать всем нормам.

        FRAP хорошо об этом знает и на протяжении десятилетий гарантирует своим клиентам высочайшее качество, первоклассный сервис и высокую эффективность .

        Неслучайно некоторые из самых престижных производителей в мире (включая Renault Alpine, Alfa Romeo, KTM, Piaggio, Peugeot Scooters, CNH, AGCO Corporation, Argo Tractors и Same Deutz-Fahr Group ) имеют выбрали соединения FRAP в качестве оборудования для своих сборочных линий.

        Подпишитесь на нашу рассылку новостей

        Декарбоксилирование, антиоксидантные свойства и противоопухолевый эффект in vitro

        Abstract

        Это исследование было направлено на получение и определение характеристик экстрагированного конопляного масла, обогащенного каннабидиолом (CBD) декарбоксилированием каннабидиоловой кислоты (CBDA), и предоставление нового понимания его антиоксидантного и противоракового действия .Была проведена оптимизация декарбоксилирования CBDA в конопляном масле, и содержание и чистота CBD и CBDA были определены с помощью флэш-хроматографии, 1 H- и 13 C-ЯМР. Антиоксидантные свойства масла, обогащенного CBD, были исследованы с помощью хелатирующей активности Fe 2+ , анализа снижающей антиоксидантной способности Fe 3+ , O 2 ● — поглощающей активности, HO поглощающей способности и ингибирования перекисного окисления липидов. анализ, и его цитотоксичность, эффекты, вызывающие апоптоз и окислительный стресс, на клетки NHDF, MeWo, HeLa, HepG2 и HOS.Концентрация CBD в конопляном масле была увеличена с помощью мягкого декарбоксилирования CBDA, оптимизированного при 90 ° C, в течение 1 часа, и полученное масло было способно восстанавливать железо, улавливать свободные радикалы и ингибировать перекисное окисление липидов в бесклеточных окислительных условиях. Масло, обогащенное CBD, способствовало пролиферации NHDF до 15 мкг CBD / мл, вызывая апоптоз и продукцию ROS и модулируя экспрессию генов антиоксидантных ферментов в раковых клетках, являясь селективным для клеток остеосаркомы и индуцировало апоптоз с помощью p53- и ROS-независимых механизмов . Конопляное масло, обогащенное CBD, продемонстрировало антиоксидантные свойства в окислительных условиях и способствовало нормальной пролиферации фибробластов, вызывая апоптоз и продукцию ROS в раковых клетках.

        Ключевые слова: каннабидиол, конопляное масло, мягкое декарбоксилирование, антиоксидантные свойства, активные формы кислорода, апоптоз, остеосаркома

        1. Введение

        Cannabis sativa L. или конопля была одним из первых растений, используемых для получения волокон, масло и биомасса и выращивается специально для промышленного использования.Кроме того, продукты, полученные из конопли, используются в медицине, косметике, биотопливе и кормах для животных, а также для изготовления бумаги, лаков, красок и фиторемедиации [1]. Производство C. sativa L. и продуктов его переработки регулируется европейским законодательством, согласно которому выращивание конопли разрешено только в том случае, если она содержит менее 0,2% ( мас. / Мас. ) Δ9-тетрагидроканнабинола (ТГК) из-за его психоактивные эффекты (Постановление 1307/2013). Как и в большинстве европейских стран, продукты из конопли разрешены в Румынии до тех пор, пока их концентрация ТГК ниже 0.2%. Помимо ТГК, в конопле содержится более 100 других активных соединений [2,3,4], и в исследованиях in vitro и in vivo было обнаружено, что экстракты конопли обладают значительными синергетическими биологическими эффектами по сравнению с их отдельными соединениями. ингибирует пролиферацию, ангиогенез и метастазирование раковых клеток, а также способствует апоптозу [5]. Однако незлокачественные клетки по-разному реагируют на каннабиноиды, их жизнеспособность остается неизменной или даже увеличивается [6].

        С другой стороны, основными целями лечения рака являются уменьшение размеров опухоли, ингибирование ангиогенеза и метастазирования и, в первую очередь, индукция контролируемой гибели раковых клеток, т.е.е., апоптоз. Однако основная проблема химиотерапевтических агентов заключается в том, что они обычно имеют серьезные побочные эффекты, нападая на нормальные, здоровые клетки, а также на раковые клетки. Эту проблему можно смягчить путем использования натуральных соединений или смесей, которые имеют очень мало и легкие побочные эффекты, но проявляют противораковые свойства и / или смягчают последствия химиотерапии.

        Основным предполагаемым механизмом действия каннабиноидов в раковых клетках является индукция апоптоза путем стимуляции выработки активных форм кислорода (АФК) [6].Хорошо известно, что в живых клетках образуются АФК, такие как супероксид-анион-радикал (O 2 ● — ), гидроксильный радикал (HO ) или пероксид водорода (H 2 O 2 ). как вторичные продукты метаболизма и необходимы для нормального функционирования клеток при физиологических концентрациях [7]. H 2 O 2 активирует различные пути передачи сигналов окислительно-восстановительного потенциала и проявляет либо про-, либо антиапоптотическую активность, в зависимости от его концентрации и клеточной локализации [8].

        Следует отметить, что также несколько доклинических исследований in vitro и in vivo показали, что среди обнаруженных каннабиноидов каннабидиол (CBD) сам по себе или в сочетании со стандартными химиотерапевтическими препаратами снижает жизнеспособность раковых клеток и размер опухоли, что делает его наиболее многообещающим. каннабиноид используется для лечения различных заболеваний, в том числе рака [1]. Более того, CBD является нетоксичным и непсихоактивным каннабиноидом, который обладает широким спектром фармакологических эффектов, включая антиоксидантное и противовоспалительное, а также обезболивающее, противорвотное и стимулирующее аппетит эффекты [9].Очень важно подчеркнуть, что CBD, как известно, имеет очень низкое сродство к рецепторам CB1 и CB2 эндоканнабиноидной системы, будучи непсихоактивным, но его точный механизм действия все еще неясен [6].

        Основываясь на имеющейся информации, можно сказать, что конопляное масло, обогащенное CBD, может стать одним из самых мощных нутрицевтиков, рекомендованных в качестве адъювантов при многих заболеваниях, а также для лечения боли и уменьшения побочных эффектов химиотерапии [1] . Кроме того, экстракты конопли, содержащие каннабиноиды (включая CBD), были классифицированы как новые продукты питания в Европейском союзе (Регламент 2015/2283 о новых продуктах питания). Конопляные масла с различными концентрациями CBD с многочисленными преимуществами для здоровья и очень небольшим количеством побочных эффектов коммерчески доступны, их легко охарактеризовать и получить с помощью различных методов экстракции. Более того, концентрация CBD в конопляном масле может быть увеличена за счет декарбоксилирования основного каннабиноида, обнаруженного в конопле, каннабидиоловой кислоты (CBDA). CBDA трансформируется в CBD посредством медленного процесса декарбоксилирования, который происходит самопроизвольно при комнатной температуре в растениях и ускоряется при длительном хранении, воздействии света и более высоких температурах [10].

        Это исследование было направлено на получение и определение характеристик конопляного масла, обогащенного CBD, для использования в качестве нутрицевтика при лечении и лечении рака. Для этого мы определили наиболее эффективные условия декарбоксилирования CBDA из экстрагированного конопляного масла. Кроме того, мы исследовали бесклеточные антиоксидантные свойства конопляного масла, обогащенного CBD (хелатирующая активность ионов двухвалентного железа, анализ антиоксидантной способности ионов трехвалентного железа, O 2 ● — , поглощающая активность, HO поглощающая способность и перекисное окисление липидов. ингибиторный анализ), а также его влияние на нормальные дермальные фибробласты (NHDF), злокачественную меланому (MeWo), аденокарциному (HeLa), гепатоцеллюлярную карциному (HepG2) и остеосаркому (HOS) клетки, с акцентом на цитотоксичность, индукцию апоптоза и окислительного стресс.Результаты показывают, что конопляное масло, обогащенное CBD, проявляет антиоксидантные свойства в окислительных условиях и оказывает значительное противораковое действие на клетки MeWo, HeLa, HepG2 и HOS, будучи безопасным для нормальных фибробластов, что предполагает его потенциальное применение в качестве адъюванта в терапии рака.

        2. Материалы и методы

        2.1. C. sativa L. Рост растений

        Все экстракты были получены из одного штамма C. sativa L., обозначенного KC Dora. Растения выращивали на сельскохозяйственных угодьях на северо-востоке Румынии в соответствии с законодательством ЕС и страны (Постановление ЕС 1307/2013, Закон Румынии 339/2005).Их собирали, когда 50% из них уже цвели, а затем сушили на воздухе в темноте.

        2.2. Экстракция конопляного масла

        Для этого исследования использовали 500 г верхней трети растения. Процедура экстракции включала мацерацию тонко измельченного растения в этаноле (соотношение высушенных растений и этанола: 1: 5) при комнатной температуре в течение 30 мин при медленном перемешивании. После фильтрации твердый остаток снова промывали этанолом в соотношении 1: 2 в течение 10 мин, а затем фильтровали. Два надосадочных раствора объединяли и упаривали в вакууме при 150 мбар, 55 ° C до удаления этанола.Полученное конопляное масло хранили при 4 ° C до использования.

        2.3. CBD Очистка и характеристика

        Конопляное масло обрабатывали флэш-хроматографией с использованием колонки подходящего диаметра, заполненной на 1/3 подходящим силикагелем (230–400 меш). Образец 60 мг сырого конопляного масла разбавляли метанолом и медленно вводили в слой диоксида кремния, используя стенку колонки в качестве опоры. Элюирование других соединений проводили смесью этанол: ацетонитрил 9: 1, а затем метанолом только для элюирования CBD.

        Конечную фракцию собирали и сушили вымораживанием, получая 5 мг твердого белого соединения, представляющего очищенный CBD, из 60 мг сырого конопляного масла. Чистоту соединения проверяли с помощью спектрометра 1 H и 13 C-ЯМР с использованием спектрометра Bruker Avance NEO 400 МГц, оснащенного 5-миллиметровым зондом с обратным обнаружением z-градиента, работающим на частотах 400,1 и 100,6 МГц для . 1 H и 13 C. Образец растворяли в диметилсульфоксиде-d 6 (ДМСО-d 6 ) и спектры записывали при комнатной температуре.Химические сдвиги представлены в миллионных долях и относятся к сигналу остаточного растворителя (ссылка 1 H 2,512 частей на миллион и 13 C 39,47 частей на миллион).

        ВЭЖХ-определение CBDA и CBD в образцах сырого и декарбоксилированного конопляного масла проводили с использованием системы ВЭЖХ Perkin Elmer с детектором Flexar UV / VIS при 220 нм и 30 ° C. Фиксированная инъекционная петля объемом 10 мкл была сделана в колонке Mediterranea Sea 18 (5 мкм, 250 мм × 4,6 мм) с потоком подвижной фазы 1 мл / мин в градиенте, образованном A: Milli-Q H 2 O с 0 . 1% HCOOH, pH 2, и B: метанол [11] с 0,1% HCOOH. Оптимальные условия для анализа были следующими: фаза B линейно увеличивалась в течение 11 минут с 50 до 80%, а затем до 95% в течение следующих 2 минут, поддерживалась в течение 3 минут, затем возвращалась на 50% через 2 минуты, затем через 12 минут. уравновешивания перед следующей инъекцией [12]. Чтобы получить калибровочную кривую для CBD, был приготовлен основной раствор 1 мг / мл чистого CBD в метаноле и были выполнены серийные разведения (0,1, 0,3, 0,5, 0,6 и 0,8 мг / мл). Растворы анализировали с помощью ВЭЖХ, и концентрацию CBD наносили на график зависимости от площади пика ().

        Типичная калибровочная кривая CBD.

        Путем сравнения двух спектров ВЭЖХ одинаковой концентрации CBD и CBDA, соответственно, были получены одинаковые площади пиков. Благодаря этому наблюдению концентрации CBDA были рассчитаны с использованием того же уравнения из калибровочной кривой CBD.

        2.4. Декарбоксилирование CBDA из конопляного масла

        В этом исследовании меняли условия декарбоксилирования для отбора наилучших условий для получения максимального выхода декарбоксилирования CBDA. Поэтому конопляное масло инкубировали при 500 мбар, 60 об / мин, варьируя температуру и время: (1) 70 ° C, 1 час; (2) 70 ° C, 2 ч; (3) 70 ° C, 3 ч; (4) 70 ° C, 4 ч; (5) 80 ° C, 1 ч; (6) 80 ° C, 2 ч; (7) 80 ° C, 3 ч; (8) 80 ° C, 4 ч; (9) 90 ° C, 1 ч; (10) 90 ° C, 2 ч; и (11) 100 ° C, 1 ч.

        После декарбоксилирования каждый образец анализировали с помощью ВЭЖХ с использованием метода, описанного в разделе 2.3, определяли площади пиков и рассчитывали концентрации CBD и CBDA с использованием уравнения калибровочной кривой (раздел 2.3). Декарбоксилированное конопляное масло с максимальной эффективностью трансформации CBDA считалось конопляным маслом, обогащенным CBD, стандартизованным как мкг CBD / мл и используемым в следующих экспериментах.

        2,5. Оценка антиоксидантной активности in vitro

        2.5.1. Хелатирующая активность ионов железа (Fe
        2+ )

        Хелатирующая активность конопляного масла, обогащенного CBD, чистого CBD и сырого конопляного масла, по сравнению с галловой кислотой (в качестве общего антиоксидантного эталона) оценивалась с использованием ранее описанного метода [13 ], с некоторыми изменениями.Вкратце, обогащенное CBD конопляное масло (15 мкг CBD / мл), чистый CBD, неочищенное конопляное масло и галловая кислота были растворены в 200 мкл метанола и 100 мкл тетрагидрата хлорида железа (FeCl 2 × 4 H 2 O, 2 мМ). Метанол использовали в качестве контроля. Затем добавляли 200 мкл феррозина (2 мМ) и доводили общий объем до 2 мл этанолом. Смесь интенсивно встряхивали и инкубировали при комнатной температуре в течение 10 мин. Хелатирующую активность Fe 2+ оценивали путем измерения поглощения комплекса Fe 2+ -феррозин при 562 нм в 96-луночном планшете с использованием считывающего устройства для микропланшетов FLUOstar ® Omega (BMG LABTECH, Ортенберг, Германия). .Процент ингибирования комплекса Fe 2+ –феррозин рассчитывали по следующей формуле: Fe2 + хелатирующий эффект% = 1-AsAc × 100, где Ac — оптическая плотность контроля, а As — оптическая плотность образца [13].

        2.5.2. Ионы железа (Fe
        3+ ), снижающие антиоксидантную способность (FRAP). Анализ

        FRAP-анализ выполняли с использованием протокола, адаптированного из Li et al. [14] для обогащенного CBD конопляного масла, чистого CBD и неочищенного конопляного масла по сравнению с галловой кислотой (в качестве общего антиоксидантного эталона).Различные концентрации конопляного масла, обогащенного CBD (15–45 мкг CBD / мл), чистого CBD, неочищенного конопляного масла и галловой кислоты, растворяли в 50 мкл метанола, смешанного с 650 мкл натрий-фосфатного буфера (Na 2 HPO 4 / KH 2 PO 4 , 0,2 M, pH 6,6) и 650 мкл феррицианида калия (K 3 Fe (CN) 6 , 1%), и смесь инкубировали в течение 20 мин при 50 ° C. Через 20 мин к смеси добавляли 650 мкл трихлоруксусной кислоты (10%) и 910 мкл этого раствора смешивали с 910 мкл дистиллированной воды и 180 мкл хлорида железа (FeCl 3 , 0.1%). Оптическую плотность измеряли при 700 нм в 96-луночном планшете с использованием считывающего устройства для микропланшетов FLUOstar ® Omega (BMG LABTECH, Ортенберг, Германия). Восстанавливающая способность (%) выражалась как отношение между поглощением для 15 мкг CBD / мл и поглощением для 45 мкг CBD / мл.

        2.5.3. Супероксид-анионный радикал (O
        2 ● — ) Активность по улавливанию

        Способность обогащенного CBD конопляного масла, чистого CBD и сырого конопляного масла по сравнению с галловой кислотой (в качестве общего антиоксидантного эталона) улавливать O 2 ● — были определены с помощью метода, адаптированного после Xiong et al.[15]. Вкратце, обогащенное CBD конопляное масло (15 мкг CBD / мл), чистый CBD, неочищенное конопляное масло и галловая кислота растворяли в 40 мкл метанола, смешивали с 1,8 мл трис-HCl (0,05 M, pH 8) и инкубировали в течение 20 мин при 25 ° C на термошейкере. Метанол использовали в качестве контроля. Затем добавляли 160 мкл пирогаллола (25 мМ) и смесь инкубировали при 25 ° C на термошейкере в течение 5 минут. Затем для завершения реакции добавляли 10 мкл HCl (8 M) и измеряли оптическую плотность при 325 нм в 96-луночном планшете с использованием считывающего устройства для микропланшетов FLUOstar ® Omega (BMG LABTECH, Ортенберг, Германия).Процент улавливания рассчитывали по формуле: Скорость улавливания% = Ac -AsAs × 100, где Ac — оптическая плотность контроля, а As — оптическая плотность образца [15].

        2.5.4. Способность к очистке от гидроксильных радикалов (HO
        )

        HO Способность к очистке конопляного масла, обогащенного CBD, чистого CBD и сырого конопляного масла, по сравнению с галловой кислотой (в качестве общего антиоксидантного эталона) была определена с использованием ранее опубликованного метода [ 15], с некоторыми изменениями, а именно: конопляное масло, обогащенное CBD (15 мкг CBD / мл), чистый CBD, неочищенное конопляное масло и галловая кислота растворяли в 400 мкл метанола и энергично смешивали с 400 мкл O-фенантролина (2.5 мМ) и 400 мкл фосфатно-солевого буфера (PBS, 0,2 М, pH 7,4). Затем добавляли 400 мкл гептагидрата сульфата двухвалентного железа (FeSO 4 × 7 H 2 O, 2,5 мМ) и 400 мкл H 2 O 2 и инкубировали смесь при 37 ° C в термостате. -шейкер на 1 ч. После инкубации оптическую плотность измеряли при 536 нм в 96-луночном планшете с использованием считывающего устройства для микропланшетов FLUOstar ® Omega (BMG LABTECH, Ортенберг, Германия). Метанол использовали в качестве контроля. Процент поглощения HO рассчитывали по формуле: Скорость поглощения% = As -A1A0-A1 × 100, где As — поглощение образца; A0 — это поглощение дистиллированной воды в реакции, а A1 — поглощение H 2 O 2 в реакции [15].

        2.5.5. Анализ ингибирования перекисного окисления липидов

        Активность по ингибированию перекисного окисления липидов конопляного масла, обогащенного CBD, чистого CBD и неочищенного конопляного масла по сравнению с галловой кислотой (в качестве общего антиоксидантного эталона), измерялась ранее описанным методом [16] с некоторыми модификациями. Конопляное масло, обогащенное CBD (15 мкг CBD / мл), чистый CBD, неочищенное конопляное масло и галловая кислота растворяли в 100 мкл метанола и смешивали с 900 мкл фосфатного буфера (гидрофосфат калия в дистиллированной воде 0.2 M при pH 7) и 1000 мкл эмульсии линолевой кислоты (которая была приготовлена ​​путем смешивания 155 мкл линолевой кислоты и 175 мкг Tween-20 в 50 мл фосфатного буфера 0,2 M). Метанол использовали в качестве контроля. Смесь инкубировали при 37 ° C и 50 мкл этого раствора отбирали через 25 мин и каждые 24 ч в течение трех дней и смешивали с 1,85 мл этанола и 50 мкл раствора FeCl 2 × 4 H 2 O ( 20 мМ в 3,5% HCl). Полученный раствор тщательно перемешивали и добавляли 50 мкл раствора тиоцианата калия (KSCN) (30% в дистиллированной воде).Оптическую плотность полученного прозрачного раствора (50 мкл) регистрировали при 500 нм в 96-луночном планшете с использованием считывающего устройства для микропланшетов FLUOstar ® Omega (BMG LABTECH, Ортенберг, Германия). Эффект ингибирования рассчитывали по формуле: Эффект ингибирования% = As-AcAs × 100, где As — оптическая плотность образца, а Ac — оптическая плотность контроля [16].

        2.6. Культура клеток

        Нормальные дермальные фибробласты (NHDF, закуплены у PromoCell, Гейдельберг, Германия), злокачественная меланома (MeWo), аденокарцинома (HeLa), гепатоцеллюлярная карцинома (HepG2) и клетки остеосаркомы (HOS) (все линии злокачественных клеток, приобретенные у CLS). Lines Service GmbH, Eppelheim, Германия) выращивали в среде альфа-MEM (Lonza, Базель, Швейцария) с добавлением 10% фетальной бычьей сыворотки (FBS, Gibco, Thermo Fisher Scientific, Waltham, MA USA) и 1% пенициллина-стрептомицина. Смесь амфотерицина B (10 K / 10 K / 25 мкг, Lonza, Базель, Швейцария).

        2.7. Анализ цитотоксичности (MTS)

        Цитотоксичность измеряли с помощью анализа пролиферации клеток CellTiter 96 ® AQueous One Solution (Promega, Мэдисон, Висконсин, США) в соответствии с инструкциями производителя. Клетки высевали с плотностью 0,5 × 10 5 (NHDF) или 1 × 10 5 клеток / мл (линии злокачественных клеток) в 96-луночные планшеты, обработанные культурой ткани. Через 24 ч среду в каждой лунке заменяли 100 мкл свежей полной среды (контроль, 0 мкг CBD / мл) или различными концентрациями конопляного масла, обогащенного CBD (5, 10, 15, 20, 25 и 30 мкг CBD / мл. ).Обогащенные CBD образцы конопляного масла, используемые для лечения клеток, были получены путем серийного разбавления конопляного масла с максимальным выходом декарбоксилирования CBDA. Клетки обрабатывали в течение 48 часов и добавляли 20 мкл реагента MTS за 1-3 часа до измерения оптической плотности при 490 нм на микропланшетном ридере FLUOstar ® Omega (BMG LABTECH, Ортенберг, Германия). Эксперименты проводили в трех повторностях, и жизнеспособность обработанных клеток выражали как процент жизнеспособности контрольных клеток. Концентрация конопляного масла, обогащенного CBD, которая вызвала снижение жизнеспособности клеток на 50% (IC 50 ), была определена с помощью программного обеспечения GraphPad Prism 8 из кривых доза-ответ для каждой клеточной линии.Индекс селективности конопляного масла, обогащенного CBD, рассчитывали по формуле: SI = IC 50 нормальных клеток / IC 50 раковых клеток, как было предложено Badisa et al. [17].

        2,8. Морфологический анализ

        Клетки высевали с плотностью 0,5 × 10 5 (NHDF) или 1 × 10 5 клеток / мл (MeWo, HeLa, HepG2 и HOS) в 24-луночные планшеты, обработанные культурой ткани, разрешено придерживаться в течение ночи, затем инкубируют со свежей полной средой (контроль, 0 мкг CBD / мл) или различными концентрациями конопляного масла, обогащенного CBD (5, 10, 15, 20 и 25 мкг CBD / мл) в течение 48 часов.Обогащенные CBD образцы конопляного масла, используемые для лечения клеток, были получены путем серийного разбавления конопляного масла с максимальным выходом декарбоксилирования CBDA. После инкубации клетки визуализировали в светлом поле с помощью инвертированного микроскопа DMI 3000 B (Leica, Wetzlar, Германия). Эксперименты проводились в трех экземплярах, и изображения были получены с использованием объектива 10 × для оценки морфологических изменений.

        2.9. Окрашивание акридиновым апельсином / бромидом этидия (AO / EB) при апоптозе

        Модифицированный метод Ribble et al.[18] для окрашивания клеток AO / EB. Клетки высевали с плотностью 0,5 × 10 5 (NHDF) или 1 × 10 5 клеток / мл (MeWo, HeLa, HepG2 и HOS) в 24-луночные планшеты, обработанные культурой ткани, и давали им прилипнуть в течение ночи. затем инкубировали со свежей полной средой (контроль, 0 мкг CBD / мл) или различными концентрациями конопляного масла, обогащенного CBD (5, 10, 15, 20 и 25 мкг CBD / мл) в течение 48 часов. Обогащенные CBD образцы конопляного масла, используемые для лечения клеток, были получены путем серийного разбавления конопляного масла с максимальным выходом декарбоксилирования CBDA.После инкубации среду удаляли и клетки окрашивали раствором AO / EB (4 мкг AO / EB / мл) в течение 1 мин, затем промывали PBS и визуализировали в полной среде с использованием инвертированного микроскопа DMI 3000 B (Leica, Wetzlar , Германия). Эксперименты проводились в трех экземплярах, изображения были получены с использованием фильтра I3 и объектива 20x.

        2.10. Оценка внутриклеточного H

        2 O 2 Производство

        Внутриклеточное производство H 2 O 2 измеряли с использованием 2 ‘, 7’-дихлородигидрофлуоресцеина диацетата (DCFH-DA), как описано ранее [19].Клетки высевали с плотностью 0,5 × 10 5 (NHDF) или 1 × 10 5 клеток / мл (MeWo, HeLa, HepG2 и HOS) в 12-луночные планшеты, обработанные культурой ткани, и давали им прилипнуть в течение ночи. затем инкубировали в течение 24 часов со свежей полной средой (контроль) или конкретными концентрациями конопляного масла, обогащенного CBD (IC 50 , рассчитанное для каждой линии клеток). После инкубации клетки загружали 2 мкМ DCFH-DA в течение 20 мин при 37 ° C. После осторожной промывки клетки соскребали в бессывороточной среде и измеряли флуоресценцию при 485/520 нм в 96-луночных черных планшетах с использованием считывающего устройства для микропланшетов FLUOstar ® Omega (BMG LABTECH, Ортенберг, Германия).Эксперименты проводили в трех повторностях, и продуцирование H 2 O 2 рассчитывали как относительные единицы флуоресценции (RFU) / мг общего клеточного белка и выражали как кратное изменение контрольных значений. Общий клеточный белок определяли с использованием анализа бицинхониновой кислоты.

        2.11. Выделение РНК и анализ экспрессии генов

        Клетки высевали с плотностью 0,625 × 10 5 (NHDF) или 1,25 × 10 5 клеток / мл (MeWo, HeLa, HepG2 и HOS) в 6-луночную культуру ткани. обработанные планшеты, оставляли на ночь, затем инкубировали со свежей полной средой (контроль) или конкретными концентрациями конопляного масла, обогащенного CBD (IC 50 , рассчитанное для каждой клеточной линии) в течение 48 часов.После инкубации клетки промывали один раз PBS и общую РНК выделяли с использованием реагента TRIzol (Invitrogen, Thermo Fisher Scientific, Waltham, MA USA) в соответствии с протоколом производителя. Обратную транскрипцию (ОТ) РНК проводили в системе Veriti PCR с использованием набора для обратной транскрипции кДНК High Capacity и случайных праймеров RT (все от Applied Biosystems, Thermo Fisher Scientific, Waltham, MA USA). Количественные реакции ПЦР в реальном времени проводили на системе ПЦР в реальном времени QuantStudio 12K Flex (Applied Biosystems, Thermo Fisher Scientific, Уолтем, Массачусетс, США) с использованием пользовательских праймеров () для белка 2 B-клеточной лимфомы (BCL2) -ассоциированного X (BAX), регулятор апоптоза BCL2 (BCL2), опухолевый белок p53 (TP53), протоонкоген MDM2 (MDM2), супероксиддисмутаза 1 (SOD1), каталаза (CAT), глутатионпероксидаза 1 (GPX1), глутатион-дисульфидредуктаза ( GSR) и 18S в качестве эталонного гена (Invitrogen, Thermo Fisher Scientific, Waltham, MA USA) и SyBr Select Real-Time PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific) в соответствии с инструкциями производителя.Эксперименты проводили в трех экземплярах, и для каждого образца повторные измерения проводили в 96-луночных реакционных планшетах. Полученные данные анализировали с помощью программного обеспечения QuantStudio 12K Flex v1.2 (Applied Biosystems, Thermo Fisher Scientific, Уолтем, Массачусетс, США) с автоматической настройкой Cq. Уровень экспрессии каждого интересующего гена определяли относительно 18S (в качестве эталонного гена) и рассчитывали с использованием метода 2 -ΔΔCq [20].

        Таблица 1

        Последовательности праймеров и размер ампликона, используемые для анализа экспрессии генов с помощью ПЦР в реальном времени.

        AC 903GCTGAT3 GCTGATCA3 903GCTGATCA03 CCGTGCA3 9GCTAGC3 100 100
        Ген Идентификатор гена Последовательность 5′-3 ‘ Размер ампликона (п.н.)
        18S NR_145820.1
        БАКСА NM_138761.3 FW 5 ‘TCATGGGCTGGACATTGGAC
        RV 5′ GCGTCCCAAAGTAGGAGAGG
        96
        BCL2 NM_000633.2 FW 5 ‘GCGGCCTCTGTTTGATTTCTC
        RV 5′ CTTGTGGCCCAGATAGGCA
        TP53 NM_001276696.2 FW 5 ‘CAGCACATGACGGAGGTTGT
        RV 5′ TCATCCAAATACTCCACACGC
        125
        MDM2 NM_002392.5 FW 5 ‘CAGTAGCAGTGAATCTACAGGGA
        RV 5′ CTGATCCAACCAATCACCTGAAT
        85
        СОД1 NM_000454.4 FW 5 ‘GGAAGTCGTTTGGCTTGTGG
        RV 5′ GGGCCTCAGACTACATCCAAG
        70
        CAT NM_001752.4 FW 5 ‘CTGACTACGGGAGCCACATC
        RV 5′ AGATCCGGACTGCACAAAGG
        92
        GPX1 NM_000581.4 FW 5 ′ CAGTCGGTGTATGCCTTCTCG
        RV 5 ′ GAGGGACGCCACATTCTCG
        105
        GSR NM_000637.5 FW 5 ′ GCACTTGTGTAGTC3 FW 5 ′ GCACTTGTGTAGTC 903 Статистический анализ

        Статистический анализ выполняли с использованием программного обеспечения GraphPad Prism 8 (GraphPad Software Inc., Сан-Диего, Калифорния, США). Данные были выражены как среднее значение ± стандартная ошибка среднего и проанализированы с помощью независимого двустороннего теста (Стьюдента) t или одностороннего дисперсионного анализа с поправкой Гейссера-Гринхауса и тестом множественных сравнений Даннета, учитывая, что p <0.05 статистически значимо.

        3. Результаты и обсуждение

        3.1. Экстракция, очистка и характеристика конопляного масла

        Используются многие опубликованные методы экстракции масла из конопли с различной эффективностью для обогащения каннабиноидов. Экстракция этанолом без разложения биологически активных соединений при комнатной температуре представляется наиболее эффективным методом выделения каннабиноидов из конопли [21]. Поэтому экстракция масла этанолом при комнатной температуре от С.sativa L., обозначаемая KC Dora, культивируемая на северо-востоке Румынии (см. раздел 2.1), была проведена с последующим выпариванием растворителя в вакууме при 55 ° C, что привело к выходу экстракции 5,09% (из 1 г из растительного материала было получено 50,9 мг конопляного масла).

        Образец 60 мг сырого конопляного масла был обработан флэш-хроматографией (см. Раздел 2.3) для разделения компонентов масла. Последнюю собранную фракцию элюента сушили вымораживанием с получением 5 мг твердого белого соединения, представляющего очищенный CBD.Чистоту соединения подтверждали с помощью ЯМР 1 H и 13 C-ЯМР в растворителе ДМСО-d 6 (). Отнесения ЯМР проводили согласно литературным данным [22]: 1 H-ЯМР (400 МГц, ДМСО-d 6 , δ (м.д.)): 0,87 (3H, t, J = 8,0 Гц, H -5 ″), 1,25–1,31 (4H, м, H-3 ″ и H-4 ″), 1,48 (2H, q, J = 8,0 Гц, H-2 ″), 1,59–1,68 (8H, м , CH 3 -7, CH 3 -10 и H-5), 1,90–2,11 (2H, м, H-4), 2,31 (2H, t, J = 8.0 Гц, H-1 ″), 3,04 (1H, t, J = 8,0 Гц, H-1 ″), 3,83 (1H, d, J = 8,0 Гц, H-1), 4,42–4,45 ( 2H, м, H-9), 5,09 (1H, s, H-2), 6,02 (2H, s, H-3 ‘, H-5’) и 8,66 (2H, s, OH-2 ‘, OH- 6 ‘) и 13 C-ЯМР (100 МГц, ДМСО-d 6 , δ (м.д.)): 13,9 (CH-5 ″), 19,2 (CH 3 -10), 21,9 (CH-4 ″), 23,2 (CH 3 -7), 29,4 (CH-5), 30,2 (CH-4 и CH-2 ″), 30,9 (CH-3 ″), 34,9 (CH-1 ″), 35,5 ( СН-1), 43,6 (СН-6), 106,6 (СН-3 ‘и СН-5’), 109,6 (СН-9), 114,1 (C-1 ‘), 126.8 (CH-2), 129,9 (C-3), 140,1 (C-4 ‘), 149,1 (C-8) и 156,2 (C-2’ и C-6 ‘).

        Спектры ЯМР чистого CBD в ДМСО-d 6 : ( a ) 1 Спектры ЯМР Н в диапазоне δ 10–2,5 м.д. ( b ) 1 Спектры ЯМР Н в диапазоне δ 2,8–0,5 м.д. ( c ) полный спектр 13 C-ЯМР; ( d ) 13 Спектры ЯМР 13С в интервале δ 45–10 м.д.

        ВЭЖХ-анализ экстрагированного сырого конопляного масла выявил 9,14% ( мас. / Мас. ) CBD и 13.54% ( w / w ) CBDA ().

        Типичная хроматограмма ВЭЖХ для сырого экстрагированного конопляного масла. CBD: каннабидиол, CBDA: каннабидиоловая кислота.

        3.2. Декарбоксилирование CBDA из конопляного масла

        Как упоминалось ранее, CBDA является наиболее распространенным каннабиноидом в растениях C. sativa L. и вырабатывается синтазой каннабидиоловой кислоты из каннабигероловой кислоты. В результате медленного процесса декарбоксилирования, который происходит спонтанно при комнатной температуре у растений, CBDA частично трансформируется в CBD [10].Более того, после повышения температуры окружающей среды наблюдался более эффективный процесс декарбоксилирования, приводящий к более высокому содержанию CBD, нейтрального каннабиноида, который является фармакологически активным соединением в конопле [10].

        Чтобы получить терапевтически ценный продукт, характеризующийся более высокой концентрацией CBD по сравнению с CBDA, CBDA в конопляном масле можно подвергнуть реакции декарбоксилирования. С этой целью Citti et al. [10] выполнили декарбоксилирование CBDA из масла семян конопли и сравнили выход CBD после декарбоксилирования CBDA в открытом реакторе при 80–120 ° C и в закрытом реакторе при 120 ° C.Это исследование показало, что если процесс декарбоксилирования происходит при высоких температурах (более 100 ° C), наблюдается значительная потеря (до 60%) общей концентрации CBDA и CBD, что означает, что это агрессивный процесс для экстракта. и может привести к деградации биологически активных молекул [10]. Чтобы определить максимальный выход CBDA в CBD без разложения, в настоящем исследовании реакции декарбоксилирования проводили в различных мягких условиях (70–100 ° C, 1–4 ч, 500 мбар, 60 об / мин) (см. Раздел 2.4). Полученные образцы конопляного масла были проанализированы с помощью ВЭЖХ (), и концентрации CBD и CBDA были рассчитаны с использованием того же уравнения калибровочной кривой () из-за того, что молярный коэффициент экстинкции обоих соединений при 220 нм одинаков. . Декарбоксилированное конопляное масло с максимальной эффективностью трансформации CBDA считалось конопляным маслом, обогащенным CBD, стандартизованным как мкг CBD / мл и используемым в следующих экспериментах. Условия декарбоксилирования и их соответствующие результаты суммированы в.Данные показали, что самое высокое содержание CBD в конопляном масле вместе с самым высоким выходом декарбоксилирования CBDA достигается после обработки конопляного масла при 90 ° C при 60 об / мин и 500 мбар. Более того, время реакции не оказало значительного влияния на выход и концентрацию CBD и CBDA: через 1 и 2 часа декарбоксилирования при 90 ° C, 60 об / мин и 500 мбар выходы 95,72 и 95,28%, соответственно, были получены от исходных концентраций. Превращение CBDA в CBD составило 66,62% за время реакции 1 ч и 73.41% в течение 2 часов реакции с получением 17,2% ( масс / масс ) CBD и 4,52% ( масс / масс ) CBDA через 1 час и 17,82% ( масс / масс ) CBD и 3,8% ( масс. / w ) CBDA через 2 часа соответственно, что составляет 8,6 и 8,91 мг CBD / г растительного материала, что в 35,4 и 36,5 раз выше, чем сообщалось для масла семян конопли (0,244 мг CBD / г растительного материала) [23]. Реакции декарбоксилирования, проводимые при температурах ниже 90 ° C, были менее эффективными (выход превращения CBDA около 68%), в то время как при 100 ° C и времени реакции 1 ч выход трансформации составлял 80.06%, но концентрация CBD немного снизилась из-за процессов разложения, характерных для более высоких температур, как показано Citti et al. [10].

        Типичные хроматограммы ВЭЖХ декарбоксилированного конопляного масла в различных мягких условиях: ( a ) 70 ° C; ( b ) 80 ° С; ( c ) 90 ° С; ( d ) 100 ° С. CBD: каннабидиол, CBDA: каннабидиоловая кислота.

        Таблица 2

        Результаты экспериментов после декарбоксилирования в мягких условиях CBDA из конопляного масла.

        4 903 903 903 903 903 903 903 903 903 903 28
        № Crt. Условия декарбоксилирования 1 CBD в 50 мг конопляного масла
        (мг)
        CBDA в 50 мг конопляного масла
        (мг)
        CBD + CBDA в 50 мг конопляного масла
        (мг)
        CBDin конопляное масло
        (%) 2
        CBDA в конопляном масле
        (%) 2
        CBD
        Преобразование из CBDA (%) 2
        CBDA + CBD Выход
        после процесса декарбоксилирования (%) 2
        CBDA
        +
        CBD
        Выход разложения (%) 2
        Сырая нефть 4.57 6,77 11,345 9,14 13,54
        1 70 ° C, 1 час 5,47 903 903 903 903 903 903 903 71,19 65,4 34,6
        2 70 ° C, 2 часа 5,7 1,89 7,59 11,4 3,78 663 903 7231
        3 70 ° C, 3 ч 6,03 2,1 8,13 12,06 4,2 68,98 71,66 28,34
        903 ч 6,17 2,05 8,22 12,34 4,1 69,72 72,45 27,55
        5 80 ° C, 1 час 14,94 4,76 64,84 86,82 13,18
        6 80 ° C, 2 ч 7,65 2,16 903 903 903 903 903 3 ч , 4 ч 7.83 1,7 9,53 15,66 3,4 74,89 84,0 16,0
        9 90 ° C, 1 ч 8,6 903 10353 902 66,62 95,72 4,28
        10 90 ° C, 2 ч 8,91 1,8 10,81 17,82 3,8 4,72
        11 100 ° C, 1 час 7,9 1,35 9,25 15,8 2,7 80,06 3,3 81,53 . Антиоксидантная активность конопляного масла, обогащенного CBD, in vitro

        В литературе антиоксидантная роль CDB основана на двух основных механизмах, специфичных для производных фенола: один основан на переносе электрона для восстановления любого соединения, а второй — на донорстве водорода. подавляют свободные радикалы [9,24].Эти два механизма были подтверждены также квантово-химическими подходами [24], и они указали, что CBD имеет хороший антиоксидантный профиль, а его химическая структура может ингибировать окислительный стресс за счет улавливания свободных радикалов. Кроме того, следует отметить, что для предотвращения цепных радикальных реакций новообразованные радикалы должны быть стабильными, и для этого Борхес и да Силва [24] показали, что стабилизация образующихся радикалов CBD выше, чем что нефенольных соединений.

        Вкратце, для определения антиоксидантных свойств натуральных экстрактов в литературе существует множество методов, основанных на двух упомянутых основных механизмах: один — это восстановление металлических частиц (например, ионов трехвалентного железа) природным соединением, а другой представляет собой реакцию природного соединения со свободным радикалом, например O 2 ● — или HO [25]. Чтобы правильно оценить антиоксидантную способность натурального экстракта или соединения, необходимо изучить оба механизма и применить как минимум два метода.

        В нашей настоящей работе антиоксидантная активность конопляного масла, обогащенного CBD, чистого CBD, неочищенного конопляного масла и галловой кислоты, была определена с использованием различных методов, направленных на два упомянутых механизма: хелатирующая активность Fe 2+ , анализ FRAP, O 2 ● — активность по улавливанию, HO способность по улавливанию и анализ ингибирования перекисного окисления липидов (см. Раздел 2.5), результаты суммированы в.

        Таблица 3

        Антиоксидантная активность конопляного масла, обогащенного CBD, чистого CBD, сырого конопляного масла и галловой кислоты.

        0.2 3 1,13
        Образцы / метод Fe 2+
        Хелатирующая активность
        (%)
        Анализ FRAP

        (%) 1
        O 2 ● —
        Активность очистки
        )
        HO
        Способность к очистке
        (%)
        Липид
        Анализ ингибирования перекисного окисления
        (%) 2
        Конопляное масло, обогащенное CBD (15 мкг CBD 903 / мл) 27335 55,0 ± 1,3 69,1 ± 3 221,5 ± 2,56 59,77 ± 2,0
        Чистый CBD (15 мкг / мл) 3,7 ± 0,1 104,6 ± 2,1 0,41 ± 0,01 167 ± 2,15 1,66 ± 0,04
        Неочищенное конопляное масло
        (15 мкг CBD / мл)
        8,0 ± 0,03 97,7 ± 1,7 1,24 ± 0,03 20,69 ± 0,63
        Галловая кислота (15 мкг / мл) 3.8 ± 0,07 95,45 ± 1,3 1,23 ± 0,01 391,38 ± 5,67 21,33 ± 1,03

        Способность природных соединений хелатировать железо представляет собой ценное антиоксидантное свойство, препятствуя катализируемому металлами окислению. В этом контексте Gülçin et al. [13] показали, что катионы Fe 2+ являются мощными окислителями, участвуют в процессах окисления липидов и генерируют ROS in vivo ; следовательно, хелаторы Fe 2+ могут обеспечивать защиту от окислительного повреждения, в то время как катионы Fe 3+ преобладают в пищевых продуктах и ​​также производят радикалы из пероксидов, но с меньшей скоростью, чем Fe 2+ .

        В нашем исследовании хелатирующую активность Fe 2+ определяли с использованием адаптированного метода Gülçin et al. [13]. Этот метод измеряет поглощение комплекса Fe 2+ –феррозин, которое уменьшается в присутствии хелатирующих агентов, что позволяет оценить хелатирующую активность конопляного масла, обогащенного CBD, чистого CBD, неочищенного конопляного масла и галловой кислоты. Концентрация 15 мкг CBD / мл в конопляном масле, обогащенном CBD, показала хелатирующую активность 27,26 ± 0,2% (), что аналогично ранее опубликованным данным для стандартных антиоксидантных соединений [13].Конопляное масло, обогащенное CBD, определяет снижение оптической плотности аналогично контрольному образцу (метанол). Между тем, для остальных образцов мы получили очень низкие значения. Очищенный CBD и галловая кислота имели почти одинаковые значения, что позволяет предположить, что многочисленные соединения в конопляном масле обладают синергическим антиоксидантным действием, более высоким, чем у отдельных очищенных активных веществ.

        Антиоксидантная активность конопляного масла, обогащенного CBD, чистого CBD, сырого конопляного масла и галловой кислоты различных концентраций также определялась с помощью анализа FRAP.Анализ FRAP основан на прямом восстановлении феррицианида до ферроцианида антиоксидантными соединениями (т.е. фенольными производными) с последующим образованием прусского комплекса Перла (интенсивный синий цвет) в присутствии Fe 3+ и оптической плотности при 700 нм. Количество образующегося комплекса прямо пропорционально восстановительной способности исследуемых соединений [7]. В нашем случае конопляное масло, обогащенное CBD, в концентрациях 15–45 мкг CBD / мл продемонстрировало эффективную восстанавливающую антиоксидантную способность 55% () в зависимости от дозы с r 2 = 0.9463 (), что соответствует другим фенольным производным [9,13]. Другие изученные соединения определили почти одинаковую абсорбцию независимо от концентрации, а восстанавливающая антиоксидантная способность была более 100% для чистого CBD и почти 100% для сырого конопляного масла и галловой кислоты.

        Анализ FRAP конопляного масла, обогащенного CBD (15–45 мкг CBD / мл), чистого CBD, сырого конопляного масла и галловой кислоты.

        Антиоксидантная способность растительных биоактивных соединений может быть оценена также по способности соединений нейтрализовать АФК с коротким периодом полураспада, например O 2 ● — (умеренно реактивный) и HO (высокореактивный ), которые образуются в различных метаболических процессах и могут привести к перекисному окислению липидов и повреждению тканей [13].

        В нашем случае, как это видно на примере, обогащенное CBD конопляное масло в концентрации 15 мкг CBD / мл продемонстрировало высокую способность к инактивации O 2 ● — и HO сверхреактивных радикалов, согласившись с другими опубликованными данными [26,27,28], в то время как для других проанализированных образцов мы получили значения около 1. Еще раз подтверждается, что изолированные соединения обладают более низкой антиоксидантной активностью по сравнению с исходным экстрактом конопли.

        Последним методом, применявшимся для определения активности поглощения АФК, был анализ перекисного окисления липидов, который инициируется O 2 ● — и HO посредством свободнорадикальных цепных реакций [13].Количество перекисей липидов, образующихся в процессе, можно измерить с помощью метода тиоцианата железа (III). Мы определили высокий ингибирующий эффект перекисного окисления липидов конопляного масла, обогащенного CBD, — 15 мкг CBD / мл в течение 4 дней (59,77 ± 2%), что в 2,7 раза выше, чем для сырого конопляного масла, и в 2,8 раза выше, чем для галловой кислоты.

        Взятые вместе, эти результаты показывают, что конопляное масло, обогащенное CBD, обладает высокой антиоксидантной активностью, способно восстанавливать железо, улавливать свободные радикалы и ингибировать перекисное окисление липидов.

        3.4. Цитотоксичность конопляного масла, обогащенного CBD

        Цитотоксичность для нормальных фибробластов (NHDF) и линий злокачественных клеток (MeWo, HeLa, HepG2 и HOS) конопляного масла, обогащенного CBD, определяли с помощью анализа MTS после 48 ч инкубации. Обогащенные CBD образцы конопляного масла с различными концентрациями CBD, используемые для обработки клеток, были получены путем серийных разведений масла, экстрагированного из C. sativa L., культивируемой в северо-восточной Румынии, с максимальным выходом декарбоксилирования CBDA.

        Результаты показывают, что конопляное масло, обогащенное CBD, способствовало пролиферации нормальных фибробластов при концентрациях до 15 мкг CBD / мл с последующим цитотоксическим действием при более высоких концентрациях (), что согласуется с другими опубликованными данными [29,30,31 , 32].

        Цитотоксичность конопляного масла, обогащенного CBD, на нормальные кожные фибробласты (NHDF), злокачественную меланому (MeWo), аденокарциному (HeLa), гепатоцеллюлярную карциному (HepG2) и остеосаркому (HOS). Контрольные клетки инкубировали с полной средой для культивирования клеток (представленной как 0 мкг CBD / мл). Жизнеспособность обработанных клеток выражали как процент жизнеспособности контрольных клеток. Данные были представлены как среднее значение ± стандартная ошибка среднего. * p <0,05, ** p <0,01 по сравнению с клетками NHDF (односторонний дисперсионный анализ: MeWo p = 0.0052, HeLa p = 0,0149, HepG2 p = 0,0400, HOS p = 0,0065).

        Что касается жизнеспособности злокачественных клеток, то ее снижение начиналось при концентрации 5 мкг CBD / мл, более выраженным или меньшим образом, в зависимости от линии злокачественных клеток. Таким образом, жизнеспособность линии клеток HOS резко снижалась даже при концентрации 5 мкг CBD / мл, в то время как для клеток HepG2, HeLa и MeWo при концентрации 10 мкг CBD / мл ().

        Принимая во внимание эти результаты, можно сделать вывод, что диапазон оптимальных концентраций составляет от 5 до 15 мкг CBD / мл, поскольку пролиферация фибробластов не затрагивается, в то время как может наблюдаться снижение жизнеспособности раковых клеток.

        Кроме того, важным параметром при изучении противоракового действия различных соединений является полумаксимальная ингибирующая концентрация на жизнеспособность клеток (IC 50 ), что в нашем случае означает количество CBD, необходимое для снижения жизнеспособности клеток на 50%. Другим важным параметром является индекс селективности (SI) соединений по отношению к клеточным линиям. Когда значения SI выше 2, можно рассматривать хорошую селективность соединения по отношению к определенной линии рака, а также, чем выше значение, тем лучше рассматривается селективность по отношению к линии клеток, в то время как значения SI <2 предполагают общую токсичность, таким образом затрагивая и нормальные клетки [17].SI был рассчитан, как было предложено Badisa et al. [17], так как SI = IC 50 нормальных клеток / IC 50 изучаемых раковых клеток.

        Данные, представленные в, предполагают, что обогащенное CBD конопляное масло наиболее эффективно в отношении клеток HOS (SI = 3,16), при этом самое низкое значение IC 50 (8,42) как минимум в три раза ниже, чем значение, полученное для клеток NHDF (IC 50 = 26,65), предполагая, что обогащенное CBD конопляное масло является селективным в отношении остеосаркомы и может использоваться в качестве альтернативного или адъювантного лечения.Насколько нам известно, цитотоксические эффекты CBD или конопляного масла не исследовались при остеосаркоме. Однако некоторые исследовательские группы определили, что синтетический каннабиноид (WIN 55,212-2) индуцирует остановку клеточного цикла и стресс эндоплазматического ретикулума [33] и оказывает антипролиферативное действие отдельно или в сочетании с адриамицином в качестве цитостатического препарата на клеточных линиях остеосаркомы [34].

        Таблица 4

        Значения IC 50 и SI конопляного масла, обогащенного CBD, по отношению к клеточным линиям NHDF, MeWo, HeLa, HepG2 и HOS.

        3 4 3 4 21,59 8,42
        NHDF MeWo HeLa HepG2 HOS
        IC 50 (мкг CBD / мл) 26,65 26,65
        SI 1,23 1,58 1,58 3,16

        Конопляное масло, обогащенное CBD, показало аналогичные значения IC 50 и SI в клетках HeLa и HepG2 ().Интересно, что из данных, представленных выше, можно заметить, что обогащенное CBD конопляное масло способствовало пролиферации нормальных фибробластов при концентрациях до 15 мкг CBD / мл, что близко к IC 50 для клеток HeLa и HepG2 и почти вдвое больше. высокий как IC 50 для ячеек HOS. Принимая во внимание другие опубликованные данные, показывающие, что экстракты C. sativa и отдельные CBD проявляют антипролиферативные эффекты в клетках HeLa и HepG2 [30,31], а предварительная обработка CBD усиливает цитотоксичность цисплатина в клетках HepG2 [35], мы можем рекомендуют обогащенное CBD конопляное масло в качестве предварительного лечения или адъюванта при лечении аденокарциномы (HeLa) и гепатоцеллюлярной карциномы (HepG2).На основании полученных результатов (а) клетки злокачественной меланомы (MeWo) наименее чувствительны к конопляному маслу, обогащенному CBD, но полученные данные рекомендуют использование конопляного масла, обогащенного CBD, для местного применения при лечении меланомы. Этот вывод также подтверждается результатами Blázquez et al. [32], которые сообщили, что каннабиноиды избирательно подавляют рост клеток меланомы, и Simmerman et al. [36], которые сообщили, что CBD уменьшает рост и размер опухоли и улучшает время и качество жизни на мышиной модели меланомы, аналогично результатам, полученным для цисплатина.

        3.5. Оценка апоптоза, индуцированного обогащенным CBD конопляным маслом

        Оценка апоптоза проводилась с помощью морфологического анализа, окрашивания AO / EB и экспрессии генов, связанных с апоптозом, в нормальных фибробластах и ​​линиях злокачественных клеток, обработанных различными концентрациями конопляного масла, обогащенного CBD, для 48 ч.

        3.5.1. Морфологический анализ

        Наблюдались некоторые морфологические изменения и немного уменьшенное количество клеток NHDF, начиная с 10 мкг CBD / мл по сравнению с контрольными клетками (0 мкг CBD / мл), и, при увеличении концентраций CBD, уменьшение и отслоение клеток приводило к цитоплазматическим наблюдалась конденсация и образование пузырьков ().Клетки MeWo показали образование пузырьков при 10 мкг CBD / мл, усугубляемое увеличением концентраций CBD, которые способствовали сокращению и отслоению клеток (), что согласуется с ранее опубликованными данными [29]. Клетки HeLa демонстрировали конденсацию цитоплазмы и образование везикул, начиная с 10 мкг CBD / мл, с последующим ускоренным дозозависимым округлением, сжатием и отслоением клеток (). Более того, почти полное отделение клеток от культуральной чашки наблюдалось для клеток HeLa при 25 мкг CBD / мл (). Клетки HepG2 демонстрировали дезагрегацию сфероидов и отслоение клеток, начиная с 10 мкг / мл, амплифицированных дозозависимым образом ().Клетки HOS демонстрировали некоторое округление клеток и небольшое уменьшение количества клеток при 5 мкг CBD / мл, за которым следовали усиленные морфологические изменения при 10 мкг CBD / мл, такие как конденсация цитоплазмы, образование пузырьков, округление и отслоение клеток (). Кроме того, 15 мкг CBD / мл индуцировали обширное округление и сокращение клеток в HOS-клетках с последующим образованием везикул при 20 мкг CBD / мл и полным отрывом клеток при 25 мкг CBD / мл ().

        Морфологический анализ нормальных дермальных фибробластов (NHDF), злокачественной меланомы (MeWo), аденокарциномы (HeLa), гепатоцеллюлярной карциномы (HepG2) и остеосаркомы (HOS), обработанных конопляным маслом, обогащенным CBD, в точках 5, 10, 15, 20 и 25 мкг CBD / мл в течение 48 часов.Контрольные клетки инкубировали с полной средой для культивирования клеток (представленной как 0 мкг CBD / мл).

        3.5.2. Окрашивание акридиновым апельсином / бромидом этидия (AO / EB) при апоптозе

        Окрашивание AO / EB позволяет визуализировать образование апоптотических тел и ядерные изменения, характерные для апоптоза [37]. Акридиновый оранжевый окрашивает как живые, так и мертвые клетки, а бромистый этидий окрашивает только те клетки, которые утратили целостность мембраны [37]. Таким образом, живые клетки равномерно окрашены в зеленый цвет, в то время как апоптотические клетки демонстрируют конденсацию хроматина (ярко-зеленые ядра) и фрагментацию ядер, а также оранжево-красное окрашивание апоптотических телец [37].

        Чтобы определить способность конопляного масла, обогащенного CBD, вызывать апоптоз в различных линиях злокачественных клеток, клетки MeWo, HeLa, HepG2, HOS и NHDF обрабатывали различными дозами конопляного масла, обогащенного CBD, в течение 48 часов и AO / Применяли окрашивание EB () в соответствии с методом, предложенным Ribble et al. [18]. В контрольных клетках (0 мкг CBD / мл) значительного апоптоза не наблюдалось. Заметим, что оранжево-красное окрашивание более отчетливо через микроскоп, чем на захваченных изображениях.

        Окрашивание AO / EB нормальных дермальных фибробластов (NHDF), злокачественной меланомы (MeWo), аденокарциномы (HeLa), гепатоцеллюлярной карциномы (HepG2) и клеток остеосаркомы (HOS), обработанных конопляным маслом, обогащенным CBD, в точках 5, 10, 15, 20 и 25 мкг CBD / мл в течение 48 часов. Контрольные клетки инкубировали с полной средой для культивирования клеток (представленной как 0 мкг CBD / мл).

        Из этого можно наблюдать, что фибробласты проявляли первые признаки апоптоза (такие как конденсация хроматина и образование пузырьков) при концентрациях 20 мкг CBD / мл, и были произведены более выраженные цитоплазматические и ядерные изменения при 25 мкг / мл, в то время как злокачественные клетки имели разное поведение в зависимости от дозы CBD.

        Клетки MeWo () показали несколько апоптотических телец (окрашенных оранжево-красным), конденсацию хроматина и сжатие цитоплазмы при 5 мкг CBD / мл с последующей фрагментацией ядра при 10 мкг CBD / мл. Степень апоптоза в клетках MeWo увеличилась, что привело к уменьшению количества клеток в зависимости от дозы.

        Клетки HeLa () демонстрируют цитоплазматическую конденсацию, начиная с 10 мкг CBD / мл, усугубляющуюся увеличением концентрации CBD. Инкубация клеток HeLa с 20 мкг CBD / мл способствовала фрагментации ядра и образованию везикул с последующим увеличением гибели и отслоения клеток при 25 мкг / мл, что согласуется с результатами Lukhele и Motadi [30], которые продемонстрировали, что CBD и другие С.экстракты sativa вызывают апоптоз в клетках HeLa.

        Начиная с 5 мкг / мл, в клетках HepG2 происходила конденсация хроматина и фрагментация ядра (), сопровождаемая дезагрегацией сфероидов и отслоением клеток, также в зависимости от дозы. Концентрации 20 и 25 мкг CBD / мл вызывали явные апоптотические особенности и почти полное отрывание клеток в клетках HepG2. Следует отметить, что Manosroi et al. [31] также сообщили об индукции апоптоза в клетках HeLa и HepG2 экстрактами листьев конопли (без информации о содержании каннабиноидов).

        Клетки

        HOS демонстрировали конденсацию хроматина, сжатие и отслоение клеток, начиная с 10 мкг CBD / мл, а также образование апоптотических телец (окрашенных в красный цвет), начиная с 15 мкг CBD / мл (). Более того, инкубация клеток HOS с 25 мкг CBD / мл приводила к полному отсоединению клеток от планшетов для культивирования. Насколько нам известно, апоптоз, вызванный CBD или конопляным маслом, не зарегистрирован для клеток остеосаркомы.

        3.5.3. Экспрессия генов, связанных с апоптозом

        Экспрессия генов BAX, BCL2, TP53 и MDM2 определялась относительно 18S (в качестве контрольного гена) с помощью количественной ПЦР в реальном времени (см. Раздел 2.11 и), рассчитанные по методу 2 — ΔΔCq [20]. Для этого клетки инкубировали со свежей полной средой (контроль, 0 мкг CBD / мл) или конкретными концентрациями конопляного масла, обогащенного CBD (IC 50 , рассчитанное для каждой клеточной линии) в течение 48 часов (см. Раздел 2.11).

        Помимо измерений экспрессии генов BAX и BCL2 в клетках, обработанных IC 50 конопляного масла, обогащенного CBD, в течение 48 часов (см. Раздел 2.11), были рассчитаны отношения BAX / BCL2 для определения устойчивости клеток к апоптозу.Известно, что BAX способствует гибели клеток, в то время как BCL2 ингибирует активность BAX и предотвращает апоптоз [38], поэтому соотношение BAX / BCL2 <1 указывает на то, что клетки устойчивы к апоптозу, а соотношение> 1 подразумевает чувствительность к апоптозу. стимулы [39,40]. Как можно видеть на фиг.4, когда клеточные линии обрабатывали дозами IC 50 конопляного масла, обогащенного CBD, в течение 48 часов, отношения BAX / BCL2, соответствующие линиям NHDF, HeLa, HepG2 и HOS, были меньше 1, и соотношение BAX / BCL2 было выше 1 в случае клеточной линии MeWo с p <0.05. Это говорит о том, что клетки HeLa, HepG2 и HOS устойчивы к апоптозу, но, тем не менее, они подвергаются апоптозу при более низких концентрациях конопляного масла, обогащенного CBD, по сравнению с клетками MeWo, что доказано морфологическим анализом и окрашиванием AO / EB. Результаты, полученные для клеток MeWo, согласуются с ранее опубликованными данными [39] и могут иметь значение при лечении рака из-за повышенной чувствительности клеток меланомы, предварительно обработанных CBD, к стандартной химиотерапии.

        Коэффициент экспрессии гена BAX / BCL2 в нормальных дермальных фибробластах (NHDF), злокачественной меланоме (MeWo), аденокарциноме (HeLa), гепатоцеллюлярной карциноме (HepG2) и остеосаркоме (HOS), обработанных клетками IC 50 CBD, специфичными для линии клеток -обогащенное конопляное масло в течение 48 ч.Контрольные клетки инкубировали с полной средой для культивирования клеток. Эксперименты проводили в трех повторностях, полученные данные выражали как среднее значение 2 — ΔΔCq (по сравнению с 18S контрольных клеток) ± стандартная ошибка среднего. * p <0,05, ** p <0,01, *** p <0,001 по сравнению с контрольными клетками (NHDF p <0,0001, MeWo p = 0,013391, HeLa p = 0,049447, HepG2 p = 0,000092, HOS p = 0,002741).

        Опухолевый супрессор p53 играет важную роль в регуляции клеточного стрессового ответа, активируя транскрипцию различных генов, участвующих в остановке клеточного цикла и апоптозе [41].p53 повышает экспрессию гена BAX и подавляет экспрессию гена BCL2, изменяя соотношение BAX / BCL2 и влияя на чувствительность клетки к апоптотическим стимулам [39]. Более того, p53 и протоонкоген MDM2 связаны посредством ауторегуляторной петли обратной связи, в которой первый активирует экспрессию MDM2, а второй подавляет p53, что приводит к ингибированию p53-зависимого апоптоза [41]. В раковых клетках ген p53 часто мутирован, или функция p53 дикого типа затрудняется сверхэкспрессией MDM2, что приводит к ингибированию путей подавления опухоли и устойчивости к апоптотическим стимулам [41].

        В нашем случае экспрессия генов TP53 и MDM2 в клетках, обработанных IC 50 конопляного масла, обогащенного CBD, в течение 48 часов, показала, что обогащенное CBD конопляное масло индуцировало значительное подавление TP53 во всех линиях клеток (а) . Это предполагает, что конопляное масло, обогащенное CBD, способствовало апоптозу в исследуемых линиях злокачественных клеток посредством p53-независимых механизмов, которые противоречат результатам Lukhele и Motadi [30], которые сообщают, что CBD и другие экстракты C. sativa повышают — регулируют экспрессию белка p53 в клетках HeLa.Более того, наши результаты показывают, что введение обогащенного CBD конопляного масла в концентрациях IC 50 индуцировало значительное подавление экспрессии гена MDM2 в клетках MeWo и HeLa, но в клетках HepG2 была отмечена значительная повышающая регуляция MDM2 (b) . В соответствии с нашими результатами в клетках HepG2, Alharris et al. [42] сообщили, что CBD подавляет экспрессию гена и белка TP53 и повышает экспрессию MDM2 в клетках нейробластомы. Поскольку сверхэкспрессия MDM2 связана с метастазированием, резистентностью к химиотерапии и плохим прогнозом, возможным способом лечения рака может быть ингибирование экспрессии или функции MDM2 [41].Из-за антагонистических результатов воздействия CBD и конопляного масла на экспрессию генов TP53 и MDM2, необходимы дополнительные данные для выяснения этого механизма при других типах рака.

        ( a ) экспрессия гена TP53; ( b ) Экспрессия гена MDM2 в нормальных фибробластах кожи (NHDF), злокачественной меланоме (MeWo), аденокарциноме (HeLa), гепатоцеллюлярной карциноме (HepG2) и остеосаркоме (HOS), обработанных клетками IC 50 , специфичными для клеточной линии CBD -обогащенное конопляное масло в течение 48 ч. Контрольные клетки инкубировали с полной средой для культивирования клеток.Эксперименты проводили в трех повторностях, полученные данные выражали как среднее значение 2 — ΔΔCq (по сравнению с 18S контрольных клеток) ± стандартная ошибка среднего. * p <0,05, ** p <0,01, *** p <0,001 по сравнению с контрольными клетками (TP53: NHDF p = 0,001014, MeWo p = 0,000003, HeLa p = 0,000669 , HepG2 p = 0,001736, HOS p = 0,000011; MDM2: NHDF p = 0,065319, MeWo p = 0.001181, HeLa p = 0,002125, HepG2 p = 0,000358, HOS p = 0,033260).

        3.6. Оценка окислительного стресса, вызванного конопляным маслом, обогащенным CBD

        Было показано, что CBD вызывает апоптоз, стимулируя выработку ROS и, следовательно, увеличивая активность антиоксидантных ферментов [6]. Чтобы определить индукцию окислительного стресса в клетках, обработанных конопляным маслом, обогащенных CBD, измеряли внутриклеточную продукцию H 2 O 2 и экспрессию генов некоторых ключевых антиоксидантных ферментов.

        3.6.1. Внутриклеточная продукция H
        2 O 2

        Продукция H 2 O 2 была определена в различных линиях злокачественных клеток (MeWo, HeLa, HepG2 и HOS) и нормальных фибробластах (NHDF), обработанных специфическими клеточными линиями. IC 50 конопляного масла, обогащенного CBD (), в течение 24 часов. Интересно, что конопляное масло, обогащенное CBD, вызывало повышенную продукцию H 2 O 2 во всех линиях клеток по сравнению с необработанными (контрольными) клетками, и это было значительно выше в клетках HeLa и HepG2 ().Этот результат находится в прямом противоречии с результатами, полученными нами в отношении бесклеточной антиоксидантной активности (см. Раздел 3.3). Хотя известно, что CBD оказывает антиоксидантное действие при различных воспалительных состояниях, модулируя активность антиоксидантных ферментов и продукцию ROS [9], он может индуцировать продукцию ROS в раковых клетках как средство для индукции апоптоза [6]. Наши результаты также показывают, что обогащенное CBD конопляное масло вызывает небольшое увеличение продукции H 2 O 2 в клетках NHDF при дозах IC 50 , в отличие от результатов Massi et al.[43], которые сообщают, что CBD индуцирует зависящую от времени продукцию ROS в клетках глиомы, но не в нормальных глиальных клетках. В заключение этого раздела мы можем сделать вывод, что CBD может действовать как продуцент H 2 O 2 в раковых клетках, но необходимы более обширные исследования.

        Внутриклеточный H 2 O 2 продуцирование нормальных дермальных фибробластов (NHDF), злокачественной меланомы (MeWo), аденокарциномы (HeLa), гепатоцеллюлярной карциномы (HepG2) и остеосаркомы (HOS), обработанных клетками IC , специфичными для клеточной линии 50 доз конопляного масла, обогащенного CBD, в течение 24 часов.Контрольные клетки инкубировали с полной средой для культивирования клеток. Эксперименты проводили в трех повторностях, полученные данные выражали как относительные единицы флуоресценции (RFU) / мг белка, выражали как кратное изменение контрольных значений и представляли как среднее ± стандартная ошибка среднего. * p <0,05 по сравнению с контрольными клетками (NHDF p = 0,058216, MeWo p = 0,160015, HeLa p = 0,011617, HepG2 p = 0,020345, HOS p = 0,055959).

        3.6.2. Экспрессия гена антиоксидантных ферментов

        SOD1 катализирует превращение высокореактивного O 2 ● — в менее реакционноспособный H 2 O 2 , который в дальнейшем может быть преобразован CAT в воду и молекулярный кислород или восстановлен. посредством GPX1 с использованием глутатиона, а GSR восстанавливает внутриклеточный глутатион [44]. В культивируемых клетках добавление H 2 O 2 вызывает дозозависимое увеличение экспрессии генов SOD1, CAT и GPX1 [44].

        Насколько нам известно, влияние конопляного масла, обогащенного CBD, на экспрессию генов антиоксидантных ферментов в клетках MeWo, HeLa, HepG2 и HOS не исследовалось, и, как результат, в этом исследовании экспрессия генов SOD1 , CAT, GPX1 и GSR в клетках, обработанных IC 50 доз конопляного масла, обогащенного CBD, специфичных для каждой клеточной линии () в течение 48 часов (). Из a можно наблюдать, что экспрессия гена SOD1 была снижена в клетках NHDF, MeWo, HeLa и HepG2, обработанных конопляным маслом, обогащенным CBD, со специфическими концентрациями IC 50 , что позволяет предположить, что H 2 O 2 продуцируется в основном за счет другие SOD.Более того, Usami et al. [45] сообщили, что в супернатантах 105000 × г и печени мышей CBD снижает активность SOD. Кроме того, в клетках NHDF и MeWo, обработанных конопляным маслом, обогащенным CBD, экспрессия генов CAT и GPX1 (b, c) была значительно снижена, что свидетельствует о том, что H 2 O 2 инактивируется различными механизмами. Между тем, в обработанных клетках HeLa и HepG2 (b, c) экспрессия гена CAT также была значительно снижена, но экспрессия GPX1 была немного увеличена, что позволяет предположить, что GPX1, а не CAT, инактивирует H 2 O 2 , продуцируемый после CBD- обработка обогащенным конопляным маслом коррелирует со значительно повышенными уровнями H 2 O 2 в обработанных клетках.Аналогичные результаты были получены Usami et al. [45], поскольку они показали, что в супернатантах 105000 × г печени мышей CBD снижает активность CAT и увеличивает активность GPX1 и GSR.

        Экспрессия гена: ( a ) SOD1; ( b ) CAT; ( c ) GPX1; ( d ) GSR ​​в нормальных дермальных фибробластах (NHDF), злокачественной меланоме (MeWo), аденокарциноме (HeLa), гепатоцеллюлярной карциноме (HepG2) и остеосаркоме (HOS), обработанных клетками, специфичными для клеточной линии IC 50 CBD-обогащенных конопляное масло на 48 ч.Контрольные клетки инкубировали с полной средой для культивирования клеток. Эксперименты проводили в трех повторностях, полученные данные выражали как среднее значение 2 — ΔΔCq (по сравнению с 18S контрольных клеток) ± стандартная ошибка среднего. * p <0,05, ** p <0,01, *** p <0,001 по сравнению с контрольными клетками (SOD1: NHDF p = 0,003067, MeWo p = 0,001484, HeLa p <0,000001 , HepG2 p = 0,001186, HOS p = 0,796912; CAT: NHDF p = 0.002620, MeWo p = 0,000004, HeLa p <0,000001, HepG2 p = 0,000146, HOS p = 0,821580; GPX1: NHDF p = 0,000002, MeWo p = 0,000027, HeLa p = 0,057635, HepG2 p = 0,337276, HOS p = 0,267738; GSR: NHDF p = 0,019436, MeWo p <0,000001, HeLa p = 0,001320, HepG2 p = 0,026340, HOS p = 0,006656).

        В нормальных клетках (NHDF) после обработки конопляным маслом, обогащенного CBD, в течение 48 часов экспрессия гена GPX1 была значительно снижена (c), но экспрессия гена GSR увеличилась (d).Это открытие свидетельствует о большей устойчивости клеток к окислительным процессам за счет увеличения уровня глутатиона. Между тем, клетки MeWo, обработанные конопляным маслом, обогащенным CBD, показали значительно сниженную экспрессию генов GPX1 и GSR, что свидетельствует об их восприимчивости к окислительному стрессу. Это открытие, вместе с чувствительностью клеток MeWo к апоптотическим стимулам, предполагает, что обогащенное CBD конопляное масло индуцирует апоптоз в клетках MeWo с помощью механизмов, связанных с ROS.

        В обработанных клетках HOS на экспрессию генов SOD1, CAT, GPX1 и GSR в значительной степени не влияла обработка конопляным маслом, обогащенным CBD ().Если мы объединим эти результаты с тем фактом, что наблюдалось небольшое увеличение продукции H 2 O 2 , можно сделать важный вывод, а именно, что обогащенное CBD конопляное масло индуцирует апоптоз в HOS-клетках посредством ROS-независимых механизмов.

        4. Выводы

        В заключение, конопляное масло экстрагировали этанолом при комнатной температуре от ° C. Sativa L. обозначается KC Dora, культивируется в северо-восточной Румынии, и после вакуумного испарения растворителя выход 5 .Получено 09% из растительного материала. Содержание и чистоту CBD в экстрагированном конопляном масле определяли с помощью флэш-хроматографии и 1 H- и 13 C-ЯМР, соответственно. Мы нашли наиболее эффективные условия декарбоксилирования CBDA из конопляного масла (90 ° C в течение 1 или 2 часов), что дает конопляное масло, обогащенное CBD, без значительного разложения биоактивных соединений.

        Полученное конопляное масло, обогащенное CBD, способно восстанавливать железо, улавливать свободные радикалы и ингибировать перекисное окисление липидов в окислительных условиях, что позволяет предположить, что оно может защищать нормальные клетки от окислительного повреждения.И наоборот, конопляное масло, обогащенное CBD, индуцировало производство ROS в раковых клетках, но для выяснения точных механизмов необходимо провести более обширные исследования. Кроме того, конопляное масло, обогащенное CBD, способствовало пролиферации нормальных фибробластов при концентрации CBD до 15 мкг / мл, будучи цитотоксичным для раковых клеток. Насколько нам известно, это первое исследование по изучению цитотоксического действия CBD или конопляного масла на клетки остеосаркомы, и результаты показывают, что обогащенное CBD конопляное масло было селективным в отношении клеток остеосаркомы и индуцировало апоптоз дозозависимым образом. с помощью p53- и ROS-независимых механизмов.

        Конопляное масло, обогащенное CBD, способствовало апоптозу в исследуемых линиях злокачественных клеток через p53-независимые механизмы, что противоречит другим опубликованным данным [30]. Из-за антагонистических результатов воздействия CBD и конопляного масла на экспрессию генов TP53 и MDM2, необходимы дополнительные данные для выяснения этого механизма при различных типах рака.

        Насколько нам известно, влияние конопляного масла, обогащенного CBD, на экспрессию генов антиоксидантных ферментов в клетках MeWo, HeLa, HepG2 и HOS не исследовалось.Наше исследование показало, что конопляное масло, обогащенное CBD, модулирует экспрессию генов антиоксидантных ферментов специфическим для клеточной линии образом. Наши результаты показывают, что нормальные фибробласты, обработанные конопляным маслом, обогащенным CBD, обладают большей клеточной устойчивостью к окислительному стрессу, в основном за счет повышения уровня глутатиона, в отличие от клеток злокачественной меланомы. Более того, наши результаты показывают, что обогащенное CBD конопляное масло индуцирует апоптоз в клетках MeWo с помощью механизмов, связанных с ROS. Кроме того, наши результаты показывают, что обогащенное CBD конопляное масло можно использовать в качестве предварительной обработки или адъюванта при лечении аденокарциномы (HeLa) и гепатоцеллюлярной карциномы (HepG2), а также для местного применения при лечении меланомы.

        Наше исследование было направлено на расширение знаний в этой области, и наши результаты дают новое понимание биологических эффектов конопляного масла, обогащенного CBD, и рекомендуют его в качестве адъюванта или лечения различных видов рака, особенно остеосаркомы, с многочисленными преимуществами для здоровья и очень несколько побочных эффектов. Конопляное масло, обогащенное CBD, следует рассматривать в качестве универсального нутрицевтика с приложениями для лечения и лечения рака, и, хотя CBD является основным фармакологически активным соединением в конопляном масле, обогащенном CBD, этот продукт следует рассматривать как сложную смесь биоактивных молекул с синергическими свойствами. .

        Туалетная бумага для туалетов

        Уничтожить бедность

        В настоящее время 40% населения мира не имеют доступа к туалету. Это одна из основных причин эндемической бедности и серьезное препятствие для экономического роста в некоторых из беднейших стран мира. Болезни, связанные с диареей, заполняют более половины больничных коек в странах Африки к югу от Сахары и во всем мире ежедневно убивают более 2000 детей в возрасте до 5 лет. Мы думаем, что это чушь. Вот почему мы отдаем 50% нашей прибыли WaterAid на строительство туалетов и улучшение санитарных условий в развивающихся странах.


        Считайте каждое стирание на счету
        Мы считаем, что необходимость протирания не должна означать, что мы уничтожаем всю планету. Вот почему в нашей туалетной бумаге мы используем только 100% переработанные волокна бытовых отходов. Это экономит деревья, воду и свалки, а это значит, что вы делаете все возможное, чтобы наша планета оставалась прекрасной.


        Будьте хороши для своей задницы
        Мы не используем хлор, чернила, красители или необычные духи в нашей туалетной бумаге. Мы просто измельчаем чистые волокна при сверхвысоких температурах, чтобы сделать WGAC биоразлагаемым, безопасным в септических резервуарах и таким же прочным, как и шелковисто-мягким.А поскольку она проверена только на лучших человеческих попах, наша туалетная бумага полезна как для вашей задницы, так и для всей планеты.

        Мы считаем, что чрезвычайные ситуации с туалетной бумагой — это наихудший вид чрезвычайных ситуаций, поэтому мы установили подписку на 24 и 48 рулонов, чтобы у вас никогда больше не закончилась туалетная бумага!

        Зарегистрируйтесь, и мы будем регулярно отправлять вам заказы с любой выбранной вами частотой. Мы рекомендуем частоту, основанную на количестве людей в вашем доме, и вы можете настроить частоту по ходу, приостановить доставку или отменить подписку в любое время.

        Мы отправляем бесплатно в большинство крупных городов Австралии и во многие регионы штата Виктория. В остальных случаях отдельные коробки стоят всего 8 долларов — напишите по адресу [email protected], чтобы узнать о тарифах на оптовые закупки.

        Заказы, размещенные до 10 утра с понедельника по пятницу, отправляются в тот же день и обычно доставляются в течение 1-3 рабочих дней в Мельбурн, Сидней, Перт, Аделаиду, Брисбен и Голд-Кост. Региональные заказы VIC доставляются каждый вторник и пятницу. Повсюду в Австралии требуется немного больше времени.

        Мы уверены, что вам понравится наша туалетная бумага, поэтому мы предлагаем 100% гарантию возврата денег.

        Если вы не полностью удовлетворены своей туалетной бумагой, просто верните коробку, и мы вернем вам полную стоимость покупки. Слишком легко!

        FV3000 | Конфокальный лазерный сканирующий микроскоп

        Главный лазерный сумматор Лазер фиолетового / видимого света 405 нм: 50 мВт, 488 нм: 20 мВт, 561 нм: 20 мВт, 640 нм: 40 мВт
        Один дополнительный лазерный порт для вспомогательного лазерного комбайнера или дополнительного лазерного блока
        Дополнительный лазер Вспомогательный лазерный комбайнер Максимум 3 лазерных блока:
        445 нм: 75 мВт, 514 нм: 40 мВт, 594 нм: 20 мВт, волокно подключено к основному лазерному сумматору
        Одиночный лазерный блок 445 нм: 75 мВт, 514 нм: 40 мВт или 594 нм: 20 мВт, напрямую подключен к основному лазерному сумматору
        Управление лазерным светом Основной лазерный сумматор со встроенной системой AOTF, сверхбыстрая модуляция интенсивности с отдельными лазерными линиями, дополнительное управление заслонкой, плавно регулируемое (0.1% –100%, с шагом 0,1%)
        Максимальная мощность лазера 10% или 100% при использовании нейтрального фильтра
        Сканер Метод сканирования 2 сканирующих зеркала гальванометра с серебряным покрытием 2 сканирующих зеркала гальванометра с серебряным покрытием
        1 резонансное зеркало с серебряным покрытием и 1 сканирующее зеркало для гальванометра с серебряным покрытием
        Сканер гальванометра
        (нормальное изображение)
        Разрешение сканирования: от 64 × 64 до 4096 × 4096 пикселей
        Скорость сканирования (в одну сторону): 512 × 512 с 1.1–264 с. время пикселя: 2 мкс – 1000 мкс
        Скорость сканирования (туда и обратно): 512 × 512 при 63–250 мс, 256 × 256 при 16–125 мс
        Оптический зум: 1–50 раз с шагом 0,01 раза
        Вращение сканирования: свободное вращение (360 градусов) с шагом 0,1 градуса
        Режим сканирования: PT, XT, XZ, XY, XZT, XYT, XYZ, XYλ, XYZT, XYλT, XYλZ, XYλZT
        сканирование области интереса, прямоугольник, эллипс, многоугольник, свободная область, линия, свободная линия и точка, режим торнадо только для стимуляции
        Резонансный сканер
        (высокоскоростная визуализация)
        Разрешение сканирования: от 512 × 32 до 512 × 512 пикселей
        Скорость сканирования: 30 кадров в секунду при 512 × 512, 438 кадров в секунду при 512 x 32
        Оптический зум: 1–8 раз в 0.С шагом 01X
        Режим сканирования: XT, XZ, XY, XZT, XYT, XYZ, XYλ, XYZT, XYλT, XYZ, XYλZT
        Сканирование области интереса, прямоугольник, линия
        Пинхол Одиночное точечное отверстие с электроприводом, диаметр крошечного отверстия ø50–800 мкм (с шагом 1 мкм)
        Номер поля (FN) 18
        Дихроматическая зеркальная турель 8 позиций (высокопроизводительные DM и зеркало 10/90)
        Дополнительный блок для сканера Монитор мощности лазера, дополнительный лазерный порт
        Спектральный детектор высокой чувствительности Модуль детектора Охлаждаемый фотоумножитель на основе GaAsP, 2 канала
        Спектральный метод Моторизованная объемная фазовая голографическая дифракционная решетка, моторизованная регулируемая щель,
        выбираемая ширина полосы частот: 1–100 нм, разрешение по длине волны: 2 нм
        Дихроматическая зеркальная турель 8 позиций (высокопроизводительные DM и зеркало)
        Спектральный детектор Модуль детектора Многощелочной фотоумножитель, 2 канала
        Спектральный метод Моторизованная объемная фазовая голографическая дифракционная решетка, моторизованная регулируемая щель
        выбираемая ширина полосы частот: 1–100 нм, разрешение по длине волны: 2 нм
        Дихроматическая зеркальная турель 8 позиций (высокопроизводительные DM и зеркало)
        Системный контроль Устройство управления ОС: Windows® 7 Professional 64-бит (английская версия), Windows 10 Professional 64-бит; Встроенная специализированная плата интерфейса ввода-вывода
        и аппаратный секвенсор для точной синхронизации изображений
        Отображать 30- или 32-дюймовый монитор (WQUXGA 2560 × 1600)
        Блок флуоресцентного освещения Внешний источник флуоресцентного света, волоконный адаптер к оптическому порту блока сканирования, моторизованное переключение между световым трактом LSM и флуоресцентным освещением
        Детектор проходящего света Модуль со встроенным внешним фотоумножителем проходящего света и светодиодной лампой, моторизованное переключение

        О нас — 89North

        объект (WP_Post) # 10291 (24) { [«ID»] => интервал (3515) [«post_author»] => строка (1) «1» [«post_date»] => строка (19) «2010-07-25 19:40:01» [«post_date_gmt»] => строка (19) «2010-07-26 02:40:01» [«post_content»] => string (16957) »
        КТО ЭТО 89 СЕВЕР?

        Мы привносим ноу-хау в области оптической инженерии из лучших научных лабораторий мира и применяем их новаторскими способами в самых разных отраслях промышленности.

        Science

        Флуоресценция способствовала развитию человеческого понимания клеточного мира, разработав множество новых инструментов и методов, которые позволяют нам понять наш мир на микроскопическом уровне, как на его поверхности, так и глубоко внутри.

        Мы вместе с нашей материнской компанией Chroma и многочисленными европейскими специализированными фирмами, которые мы представляем, первыми разработали многие из этих инструментов, поэтому мы стали выдающимися поставщиками и активными консультантами ведущих исследовательских институтов мира.

        Инновации

        Теперь мы применяем те же самые инструменты, методы и ноу-хау для трансформации в различных новых промышленных приложениях, от медицинских устройств до полупроводников и автомобилестроения.

        Мы применяем оптические инженерные технологии, проверенные в элитных исследовательских центрах по всему миру, в традиционных отраслях промышленности. Мы трансформируем способность компаний измерять, анализировать и совершенствовать свою продукцию с помощью света.

        Будущее

        Сегодня мы создаем уникальные и инновационные производственные решения OEM, которые завтра преобразят множество отраслей….и мы только начинаем.

        Мы уверены, что можем и вам помочь. Давайте поговорим.

        СИЛА ЛЮДЕЙ

        Новаторское машиностроение невозможно без талантливых людей. А талантливые люди работают лучше всего, когда их поддерживает культура, которая их активно поддерживает. Вот почему мы так много работаем над этим аспектом нашей компании. Для нас большая честь, что наши усилия были подтверждены статусом B Corporation и множеством наград «Лучшие места для работы». Вы не подумаете о сотрудничестве с нами?

        АНДРЕА МЕССЕР

        ОФИС-МЕНЕДЖЕР И ВНУТРЕННИЕ ПРОДАЖИ
        Андреа является опорой 89 North и участвует во всех областях операционной деятельности: отгрузка, получение, управление офисом, обслуживание клиентов и поддержка продукции.Скорее всего, если вы позвоните по номеру 89 North, голос Андреа может быть голосом, приветствующим вас. Вне офиса Андреа — женщина эпохи Возрождения, называющая себя «немного кантри, немного рок-н-роллом».

        BOB TRECROCE

        TERRITORY MANAGER
        Bob обеспечивает важную связь между нашими отделами продаж и технической поддержки наших клиентов. Его страсть к решению проблем не имеет себе равных. Его жизнерадостный характер обязательно вызовет улыбку на вашем лице, если вам посчастливится работать с ним.

        ДЖЕРРИ БИССОННЕТТ

        КООРДИНАТОР ПРОИЗВОДСТВА И МАТЕРИАЛОВ
        Джерри руководит нашим отделом закупок и управляет всеми производственными запасами. В дополнение к своему организационному и производственному опыту, Джерри является заядлым байкером и ярым поклонником Red Sox.

        МАРК ЛАПЛАНТ

        СТАРШИЙ ИНЖЕНЕР
        Марк — главный инженер-механик по проектированию изделий с более чем 35-летним опытом работы в области проектирования и разработки оборудования / изделий (он владеет более 50 ед.С. и зарубежные патенты). Вне работы Марк заядлый велосипедист на длинные дистанции, владеет и ремонтирует игровые автоматы для игры в пинбол, а также любит проводить теплые солнечные дни на озере со своей женой.

        SONNY PARROTTE

        PROCESS ENGINEER
        Sonny — инженер-механик, обладающий талантом к разработке и внедрению надежных процессов. Естественно, он возглавляет наши усилия по созданию системы управления качеством, соответствующей требованиям ISO. Уроженец Вермонтера, Сонни может кататься на сноуборде зимой и на горном велосипеде летом, а также наслаждаться отличным пивом Вермонта круглый год.

        ДЕРЕК ДЕСАНИ

        ТЕХНИК ПО МОНТАЖУ
        Дерек, часть нашей команды по сборке оптики, собирает колеса фильтров, которые часто используются в автомобильной промышленности, и другие устройства с источниками света. Сильное внимание Дерека к деталям и сосредоточенность на эффективности делают его ценным членом этой команды. В свободное от работы время Дерек любит поднимать тяжести и играть в компьютерные игры.

        ШОН ЛИН

        ДИРЕКТОР ТЕРРИТОРИИ
        Шон — преданный своему делу профессионал с более чем 15-летним опытом работы в области биомедицинской и промышленной микроскопии.Благодаря опыту Шона и его решимости найти правильный путь, мы можем его построить, исправить и / или импровизировать — Шон хочет работать с вами, чтобы найти лучшее решение для ваших конкретных потребностей.

        RYAN SAUER

        OPTICAL ENGINEER
        Ryan — талантливый инженер-оптик, который руководит проектированием, моделированием и прототипированием наших оптических систем. Эти оптические системы станут ключевыми компонентами будущих продуктов или могут использоваться для внутренних испытаний. В свободное от работы время Райан любит гулять на природе, проводить много времени в походах и фотографировать.Райан также является фанатиком кино и всегда в курсе всех последних фильмов.

        SAM STATS

        ИНЖЕНЕР ПО ПРОДУКТУ
        Сэм — инженер на все руки. Он управляет всеми этапами жизненного цикла нашей линейки продуктов LDI, от проектирования, калибровки и производства до тестирования качества и поддержки клиентов. Он также является одним из основных членов нашей команды по разработке продуктов. Вне работы Сэм любит проводить время на свежем воздухе, готовить, работать с деревом и проводить время с друзьями и семьей.

        СКОТТ ФИЛЛИПС

        ДИРЕКТОР ПО ПРОДАЖАМ
        Скотт — энциклопедист искусств и наук, чья карьера охватывает клеточную микроскопию, разработку программного обеспечения и даже профессиональный балет.Он возглавляет отдел продаж и разрабатывает новые рыночные возможности для 89 North и ее материнской компании Chroma Technologies.

        КРИС АНДЕРСОН

        ТЕРРИТОРИЙНЫЙ МЕНЕДЖЕР
        Крис, инженер-электрик, управляет продажами с дистрибьюторами, прямыми продажами в восточной части США и квалифицированно устраняет проблемы с технической помощью в сложных приложениях. Отец двоих детей, Крис любит научную фантастику и твердо придерживается мнения о том, почему арахисовое масло лучше, чем сливочное.

        ТИМ АМБРОЗ

        СТАРШИЙ ИНЖЕНЕР-ЭЛЕКТРОТЕХНИК
        Тим возглавляет нашу команду разработчиков электроники и является постоянным экспертом по физике лазерных диодов, связанных с производительностью и разработкой 89 продуктов North.Он любит пешие прогулки, катание на горных велосипедах, гонки на парусных лодках и тренировки.

        ДЖУЛИ МАРТИН

        ГЕНЕРАЛЬНЫЙ МЕНЕДЖЕР
        Джули — инженер-механик по профессии и работает в 89 North с момента нашего основания. Она наблюдает за всей операционной деятельностью и руководит нашим развитием бизнеса, разработкой продуктов и управлением программами. Вне работы Джули любит заниматься спортом, ее можно найти на свежем воздухе и на свежем воздухе в Вермонте.

        МАРА НЕЙФЕЛЬД РИВЕРА (MS, SHRM-SCP)

        Вице-президент, руководитель отдела кадров и культуры
        Мара не просто руководит нашим отделом кадров, она — пчелиная матка, стоящая за нашей культурой.Насколько она талантлива? Что ж, она только что была признана специалистом года по персоналу штата Вермонт. Вне работы Мара увлекается семьей, фехтованием, традиционной стрельбой из лука, йогой и является активным читателем науки и истории.

        ГЛЕНН ВИЛКИНС

        СПЕЦИАЛИСТ ПО ТЕХНИЧЕСКОЙ ПОДДЕРЖКЕ
        Гленн является жизненно важной частью нашего управления жизненным циклом продукта, систем качества и процессов сертификации ISO, включая документацию по продукту и внутренние рабочие процессы. Он также управляет Windchill PLM и CAD Management и создает автоматизированные процессы.Гленн — преданный семьянин, любит проекты по благоустройству дома и всегда стремится изобрести эту Следующую Большую Вещь (пока не повезло, он говорит!).

        Джанетт Бомбардье

        Главный операционный директор, технический директор
        Жанетт — одна часть лидера, одна часть — сила природы. Бывшая сотрудница IBM, она руководит нашими инженерными, техническими и производственными операциями. Насколько она талантлива? Что ж, в 2019 году она была названа инженером года штата Вермонт. Ответственность лежит на ней, куда бы она ни пошла. Она входит в состав Исполнительного совета Торговой палаты штата Вермонт, Исполнительного комитета Совета штата VT по инвестициям в рабочую силу и является попечителем системы колледжей штата Вермонт.Чтобы расслабиться, она любит работать в саду, бегать и быть на озере.

        TONY COTE

        ТЕХНИК-ПРОИЗВОДИТЕЛЬ
        Помимо создания продукта, Тони обеспечивает жизненно важное звено при переходе от проектирования к производству, информируя об аспектах дизайна, поскольку они связаны с производительностью и развитием процессов сборки. Когда он не в офисе, его можно найти, когда он готовит барбекю, работает во дворе и играет с друзьями.

        Ньюэлл Лесселл

        Главный исполнительный директор, Chroma
        Ньюэлл имеет более чем 25-летний опыт работы в сфере управленческого и управленческого консультирования в различных отраслях промышленности, от автомобильной до пищевой.Он несет общую ответственность за бизнес и следит за тем, чтобы мы выполняли наши бизнес-цели, придерживаясь наших социальных ценностей. Ньюэлл, в прошлом профессиональный механик, любит видеть, как все идет гладко. В свободное от работы время Ньюэлл любит ходить в походы, кататься на велосипеде и изо всех сил пытается овладеть классической гитарой.

        ПОЛ ХУФФАКЕР

        ТЕХНИК ПО МОНТАЖУ
        Пол собирает колеса с оптическими фильтрами, используемые в промышленном контроле и автомобилестроении, а также собирает наши источники света, уделяя особое внимание качеству и постоянному совершенствованию.Вне работы он занимается спортом, играет на гитаре и барабанах, поет, пишет стихи и играет в компьютерные игры. США и Канада, имеет степень магистра делового администрирования в Школе бизнеса им. Бута Чикагского университета. Он и его жена вместе ходили на выпускной в старшей школе! У них трое взрослых детей, и они любят заниматься садоводством, путешествовать и проводить время со своей внучкой Дороти.
        НАШЕ ВИДЕНИЕ, МИССИЯ И ЦЕННОСТИ
        Мы верим в силу людей — и фирм, в которых они работают, — вносить изменения в свои сообщества и мир в целом.
        Наше видение

        Развивайте и продвигайте инновации для создания более здорового и способного мира.

        НАША Миссия

        Наша цель — быть поставщиком мирового класса высокопроизводительной и высококачественной продукции. Мы стремимся обогатить любознательный характер всех, кто работает с 89 North и вносит свой вклад в развитие технологий.

        НАШИ ЦЕННОСТИ
        Социальное партнерство

        Мы сотрудничаем с организациями, которые придерживаются нашей приверженности социальной ответственности.

        Компании Вермонта за социальную ответственность

        Эффективность Вермонт

        Консорциум по охране окружающей среды Вермонта

        СПРОСИТЕ ИНЖЕНЕРА

        Наши специалисты могут помочь вам создать индивидуальное решение.

        EMAIL US

        НАЧАЛО РАБОТЫ

        Мы можем провести вас через наш процесс и предоставить оценку.

        EMAIL US

        Новости и события

        Рекомендуемые
        89 North запускает новый веб-сайт для расширения предложений и выделения возможностей
        12 января 2021 г.

        89 North, дочерняя компания Chroma Technology Corporation, в […]

        Подробнее351Изменено
        Mara Rivera назван Вермонтским специалистом года по кадрам
        27 сентября 2020 г.

        BELLOWS FALLS, Vt. — Мара Нойфельд Ривера, MS, SHRM-SCP, была […]

        Подробнее297Featured
        Vermont Business Magazine, Государственная палата Bestow 2019 Deane С.Премия Дэвиса по технологии Chroma
        30 июня 2020 г.

        В понедельник, 29 июня, Джон Бутин, издатель Vermont Business […]

        Подробнее334 » [«post_title»] => строка (8) «О нас» [«post_excerpt»] => строка (14) » » [«post_status»] => строка (7) «опубликовать» [«comment_status»] => строка (6) «закрыто» [«ping_status»] => строка (6) «закрыто» [«post_password»] => строка (0) «» [«post_name»] => строка (8) «о нас» [«to_ping»] => строка (0) «» [«pinged»] => строка (0) «» [«post_modified»] => строка (19) «2021-08-17 11:19:01» [«post_modified_gmt»] => строка (19) «2021-08-17 16:19:01» [«post_content_filtered»] => строка (0) «» [«post_parent»] => int (0) [«guid»] => строка (43) «http: // wpthemetestdata.wordpress.com/about/ » [«menu_order»] => int (1) [«post_type»] => строка (4) «страница» [«post_mime_type»] => строка (0) «» [«comment_count»] => строка (1) «0» [«фильтр»] => строка (3) «сырой» }

        Действительно ли упадок фраппучино оживил Starbucks?

        В 2019 финансовом году Starbucks расширилась до 18 067 ресторанов в Северной и Южной Америке по сравнению с 17 460 ресторанами год назад (изменение на 3 процента). На международном уровне этот показатель вырос до 13 189 с 11 852 — значительный рост на 11 процентов, или 1337 новых магазинов, открытых за последние 12 месяцев.

        В 2020 году Starbucks планирует открыть около 2 000 новых заведений по всему миру и примерно 600 в Северной и Южной Америке, при этом рост в США составит 3–4%.

        Однако в последние годы сеть занималась каннибализацией, поскольку она быстро разрасталась. Возможно, слишком быстро. В 2019 году сеть закрыла около 150 магазинов в густонаселенных районах США, что привело к замедлению роста городов и сосредоточению внимания на небольших магазинах, даже на модели только для самовывоза.

        Следовательно, это привело к расширению в центральных и южных регионах страны, в первую очередь за счет большой тяги.Грисмер сказал, что Starbucks — единственный бренд такого масштаба, который увеличил количество магазинов в США за последние три года и остается «далек от полного проникновения на наш внутренний рынок».

        Кроме того, уделяя особое внимание Китаю, Starbucks в настоящее время открывает ресторан примерно каждые 15 часов с конечной целью добавить 600 новых кафе в этом году к текущему количеству 4 125. Бренд оценил 5-процентный рост в стране в прошлом квартале. Однако Грисмер предупредил, что в 2020 г.компания Starbucks в Китае может вырасти всего на 1% из-за тех же проблем, которые отставали от U.Трафик S. до недавнего роста — быстрый рост.

        «Мы эффективно делаем это для самих себя, мы делаем это намеренно в интересах увеличения общего числа транзакций и общего объема продаж», — сказал он.

        Говоря о вознаграждениях, Грисмер сказал, что 90-дневная база активных участников программы лояльности Starbucks выросла по сравнению с прошлым годом на 15 процентов и составила более 17 миллионов участников к концу четвертого квартала. В Китае он увеличился на 45 процентов до 10 миллионов человек после введения в декабре прошлого года обновления программы, основанной на расходах.

        Во многом нынешние темпы роста Starbucks можно объяснить его перезапущенной платформой, которая была запущена в апреле. Структурные изменения были сосредоточены на гибкости и на том, как клиенты могут зарабатывать и использовать «звезды».

        Примечательно, что Starbucks ранее сталкивалась с проблемой трения со своим «зеленым» уровнем, когда клиентам нужно было набрать 300 звезд, чтобы достичь золотого статуса, а затем нужно было заработать еще 125, чтобы начать погашение. Это было серьезным обязательством, а не действенным стимулом для менее частых или случайных клиентов.

        В новой многоуровневой системе уровень был удален, и гости могли начать использовать всего 25 звезд. Starbucks также расширила ассортимент продуктов, доступных для выкупа. Теперь в окне от 25 до 400 звезд предлагаются товары и покупка кофе на дому.

        «И мы увидели значительную положительную реакцию клиентов на это изменение, что было именно тем, для чего мы разработали, потому что на самом деле было проведено серьезное исследование клиентов, которое было включено в разработку программы, и значительные усилия по информированию наших партнеров и клиентов о изменения, чтобы не было неожиданностей, и чтобы клиенты и партнеры могли понять ценность, которая открывается за счет обеспечения такого уровня гибкости », — сказал Грисмер.

        Starbucks Vs. Costa Coffee: как они сравниваются?

        Две сети нацелены на глобальное расширение.

        Саманта Ли / Business Insider

        Поскольку продажи на их внутренних рынках несколько снизились, и Costa Coffee, и Starbucks рассчитывают на международную экспансию для стимулирования роста.

        Китай считается здесь ключевым рынком. По данным GlobalData, розничные продажи горячих напитков только в Китае к 2022 году достигнут 34,2 миллиарда долларов, а объемы продаж горячих напитков по всем каналам выросли более чем вдвое за последние пять лет.

        Starbucks, которая в настоящее время является лидирующей сетью с 2800 точками в Китае, планирует удвоить количество магазинов до 6000 и утроить свои доходы в течение следующих пяти лет.

        Генеральный директор Starbucks Кевин Джонсон заявил в мае, что компания стремится продвинуть «культуру кофе в Китае, где вознаграждением будет здоровый, долгосрочный и прибыльный рост на десятилетия вперед», сообщает CNN Money.

        Ранее в этом месяце Starbucks также объявила о сделке с китайским гигантом электронной коммерции Alibaba о расширении своих служб доставки по всей стране.

        Между тем, у Costa Coffee, второй по величине сети кофеен в Китае, насчитывающей более 400 заведений, есть собственные планы расширения.

        В октябре 2017 года Costa Coffee купила Yueda, китайскую сеть кофеен, с которой у нее более десяти лет было совместное предприятие в Китае. Несколько месяцев спустя, в апреле, генеральный директор Costa Coffee Эллисон Бриттен объявила, что компания хочет отделиться от своей материнской компании Whitbread, чтобы облегчить свои планы по расширению, указав на Китай как на ключевую область для роста.

        «Costa станет самостоятельной компанией, зарегистрированной на бирже, и явным лидером на рынке кофе для дома в Великобритании», — говорится в заявлении Бриттена. Он будет «иметь хорошие возможности для дальнейшего развития на своей прочной международной основе с ожидаемым ростом в Китае и Costa Express».

        .

        Добавить комментарий

        Ваш адрес email не будет опубликован. Обязательные поля помечены *